search

epi2me-labs / pychopper

cDNA read preprocessing
Other
61 stars 9 forks source link

which kit parameter to choose for LSK109 kit #47

Closed alexyfyf closed 10 months ago

alexyfyf commented 11 months ago

Hi team,

I'm wondering which parameter to choose for LSK109 kit. Should I use LSK114 (to match the protocol) or PCS109 (to match chemisty)?

Thank you so much.

Alex

nrhorner commented 10 months ago

Hi @alexyfyf

The adapters for LSK109 are not supported directly in Pychopper.

You can use custom primers/adapters in Pychopper by adding them to a file like this (LSK109.fa) - Pychopper expects two sequences with names VNP and SSP.

>VNP
TTTTTTTTTTTAATGTACTTCGTTCAGTTACGTATTGC
>SSP
GCAATACGTAACTGAACGAAGTACATT

Then you can use these adapters in pychopper with -b LSK109.fa

nrhorner commented 10 months ago

No response for a while so closing