2. The Vertebrate Mitochondrial Code (transl_table=2)
AAs = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIMMTTTTNNKKSS**VVVVAAAADDEEGGGG
Starts = ----------**--------------------MMMM----------**---M------------
Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Differences from the Standard Code:
Code 2 Standard
AGA Ter * Arg R
AGG Ter * Arg R
AUA Met M Ile I
UGA Trp W Ter *
The Jannovar version used in Exomiser versions <=13.2.1 only uses the standard codon table. This means that in some cases a mitochondrial variant can be incorrectly annotated, e.g. NC_012920.1:m.15150G>A is p.(Trp135*) using the mitochondrial codon table but p.(Ter135=) with the standard table. This leads to the change being classified as a SYNONYMOUS_VARIANT rather than a STOP_GAIN.
Solution
To fix this issue update to the latest Jannovar version 0.41
Side-effects
The update includes other changes to the Jannovar data model to handle gaps in the refseq alignments, which makes the existing Jannovar data unreadable by a newer Jannovar version. Exomiser uses a protobuf representation of this data which should mitigate this but there needs to be extensive testing about wethere older Exomiser versions can safely read newer data and the updated version can read old data.
The mitochondrial codon table is slightly different to the standard eukaryotic table:
The Jannovar version used in Exomiser versions <=13.2.1 only uses the standard codon table. This means that in some cases a mitochondrial variant can be incorrectly annotated, e.g. NC_012920.1:m.15150G>A is p.(Trp135*) using the mitochondrial codon table but p.(Ter135=) with the standard table. This leads to the change being classified as a
SYNONYMOUS_VARIANT
rather than aSTOP_GAIN
.Solution
To fix this issue update to the latest Jannovar version 0.41
Side-effects
The update includes other changes to the Jannovar data model to handle gaps in the refseq alignments, which makes the existing Jannovar data unreadable by a newer Jannovar version. Exomiser uses a protobuf representation of this data which should mitigate this but there needs to be extensive testing about wethere older Exomiser versions can safely read newer data and the updated version can read old data.