Closed davidvilanova closed 2 years ago
Hi @davidvilanova,
First of all, thank you for using bacannot.
This problem have also been flagged in digIS issues. As discussed there, it seems like a problem with a new version of hmmer but that the developers have already solved.
I will try to update the docker image to contain this new version of programs and check if everything runs ok.
Then I make contact again to say if it solved or not so that you update the pipeline and docker images, ok?
๐
Sure, i will update the docker image and re-run the pipeline.
Thanks
Hi @davidvilanova,
I have just updated the docker image with the solution provided in the digIS issues. It seems to be working now.
Please update your image with docker pull fmalmeida/bacannot:v2.3
and re-run the pipeline.
Then let me know if it's now running properly!
Interesting @fmalmeida The error has changed
It seems something particular to digIS or to this contig itself.
Would you mind sending me the input fasta that you're using so I can make some tests here and think on the best solution?
The file ".nextflow.log" and the work directory (you could check which it is in the complete log message) in which this digIS is being executed would be of great help.
Here is the log file
Sep-20 13:15:03.984 [main] DEBUG nextflow.cli.Launcher - $> nextflow run fmalmeida/bacannot --prefix strain_4782 --genome ASSEMBLY_4782/2021-4782_TTAGGC-JRDKK_L001_R/shortreads_only/shovill/shovill_assembly.fasta --outdir ANNOTATION_4782 --threads 16 --resfinder_species 'Haemophilus parasuis'
Sep-20 13:15:04.058 [main] INFO nextflow.cli.CmdRun - N E X T F L O W ~ version 21.04.3
Sep-20 13:15:04.656 [main] DEBUG nextflow.scm.AssetManager - Git config: /home/david/.nextflow/assets/fmalmeida/bacannot/.git/config; branch: master; remote: origin; url: https://github.com/fmalmeida/bacannot.git
Sep-20 13:15:04.663 [main] DEBUG nextflow.scm.AssetManager - Git config: /home/david/.nextflow/assets/fmalmeida/bacannot/.git/config; branch: master; remote: origin; url: https://github.com/fmalmeida/bacannot.git
Sep-20 13:15:04.730 [main] INFO nextflow.cli.CmdRun - Launching `fmalmeida/bacannot` [cheesy_dubinsky] - revision: 0c06e66ca9 [master]
Sep-20 13:15:05.603 [main] DEBUG nextflow.config.ConfigBuilder - Found config home: /home/david/.nextflow/config
Sep-20 13:15:05.603 [main] DEBUG nextflow.config.ConfigBuilder - Found config base: /home/david/.nextflow/assets/fmalmeida/bacannot/nextflow.config
Sep-20 13:15:05.604 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /home/david/.nextflow/config
Sep-20 13:15:05.604 [main] DEBUG nextflow.config.ConfigBuilder - Parsing config file: /home/david/.nextflow/assets/fmalmeida/bacannot/nextflow.config
Sep-20 13:15:05.613 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard`
Sep-20 13:15:05.644 [main] DEBUG nextflow.config.ConfigBuilder - Applying config profile: `standard`
Sep-20 13:15:05.733 [main] DEBUG nextflow.plugin.PluginsFacade - Setting up plugin manager > mode=prod; plugins-dir=/home/david/.nextflow/plugins
Sep-20 13:15:05.734 [main] DEBUG nextflow.plugin.PluginsFacade - Plugins default=[]
Sep-20 13:15:05.735 [main] DEBUG nextflow.plugin.PluginsFacade - Plugins local root: .nextflow/plr/empty
Sep-20 13:15:05.746 [main] INFO org.pf4j.DefaultPluginStatusProvider - Enabled plugins: []
Sep-20 13:15:05.747 [main] INFO org.pf4j.DefaultPluginStatusProvider - Disabled plugins: []
Sep-20 13:15:05.749 [main] INFO org.pf4j.DefaultPluginManager - PF4J version 3.4.1 in 'deployment' mode
Sep-20 13:15:05.753 [main] INFO org.pf4j.AbstractPluginManager - No plugins
Sep-20 13:15:05.778 [main] DEBUG nextflow.Session - Session uuid: 2701f1b4-45e5-4f09-b9a7-b3088c7e0ffe
Sep-20 13:15:05.778 [main] DEBUG nextflow.Session - Run name: cheesy_dubinsky
Sep-20 13:15:05.778 [main] DEBUG nextflow.Session - Executor pool size: 24
Sep-20 13:15:05.786 [main] DEBUG nextflow.cli.CmdRun -
Version: 21.04.3 build 5560
Created: 21-07-2021 15:09 UTC (15:09 GMT)
System: Linux 5.14.5-arch1-1
Runtime: Groovy 3.0.7 on OpenJDK 64-Bit Server VM 1.8.0_292-b10
Encoding: UTF-8 (UTF-8)
Process: 1719586@localhost [127.0.0.1]
CPUs: 24 - Mem: 62.7 GB (16.9 GB) - Swap: 10 GB (9.2 GB)
Sep-20 13:15:05.793 [main] DEBUG nextflow.Session - Work-dir: /home/david/work/WGS/4_genomes/work [ext2/ext3]
Sep-20 13:15:05.802 [main] DEBUG nextflow.executor.ExecutorFactory - Extension executors providers=[]
Sep-20 13:15:05.808 [main] DEBUG nextflow.Session - Observer factory: DefaultObserverFactory
Sep-20 13:15:05.947 [main] DEBUG nextflow.Session - Session start invoked
Sep-20 13:15:06.229 [main] DEBUG nextflow.script.ScriptRunner - > Launching execution
Sep-20 13:15:06.417 [main] INFO nextflow.Nextflow - =================================================================
Sep-20 13:15:06.418 [main] INFO nextflow.Nextflow - Container-based, fmalmeida/bacannot, Genome Annotation Pipeline
Sep-20 13:15:06.418 [main] INFO nextflow.Nextflow - =================================================================
Sep-20 13:15:06.420 [main] INFO nextflow.Nextflow - Input genomes : ASSEMBLY_4782/2021-4782_TTAGGC-JRDKK_L001_R/shortreads_only/shovill/shovill_assembly.fasta
Output dir : ANNOTATION_4782
Threads : 16
Blast % ID - Virulence Genes: 90
Blast query coverage - Virulence Genes: 80
Blast % ID - AMR Genes: 90
Blast query coverage - AMR Genes: 80
Blast % ID - ICEs or Phages: 65
Blast query coverage - ICEs or Phages: 65
Blast % ID - Plasmids: 90
Blast query coverage - Plasmids: 60
Pipeline Release: master
Current home : /home/david
Current user : david
Current path : /home/david/work/WGS/4_genomes
Configuration file: /home/david/.nextflow/config
Sep-20 13:15:06.421 [main] INFO nextflow.Nextflow - ==============================================================
Sep-20 13:15:08.020 [main] DEBUG nextflow.Session - Workflow process names [dsl2]: resfinder, gff2gbk, compute_gc, merge_annotations, unicycler, find_GIs, call_methylation, phast, custom_blast_report, iceberg, unicycler_batch, vfdb, flye_batch, barrnap, digis, kofamscan, plasmidfinder, phigaro, phispy, card_rgi, flye, refseq_masher, argminer, gff_merge, create_sql, prokka, draw_GIs, kegg_decoder, platon, amrfinder, mlst, report, victors, custom_blast, jbrowse
Sep-20 13:15:08.069 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:prokka
Sep-20 13:15:08.073 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.073 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.076 [main] DEBUG nextflow.executor.Executor - [warm up] executor > local
Sep-20 13:15:08.079 [main] DEBUG n.processor.LocalPollingMonitor - Creating local task monitor for executor 'local' > cpus=24; memory=62.7 GB; capacity=1; pollInterval=100ms; dumpInterval=5m
Sep-20 13:15:08.126 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:mlst
Sep-20 13:15:08.127 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.127 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.131 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:barrnap
Sep-20 13:15:08.131 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.131 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.134 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:compute_gc
Sep-20 13:15:08.134 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.134 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.137 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:kofam` matches label `kofam` for process with name bacannot_nf:kofamscan
Sep-20 13:15:08.138 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.138 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.141 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:kofam` matches label `kofam` for process with name bacannot_nf:kegg_decoder
Sep-20 13:15:08.141 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.141 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.143 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:plasmidfinder
Sep-20 13:15:08.144 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.144 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.147 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:platon
Sep-20 13:15:08.147 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.147 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.150 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:find_GIs
Sep-20 13:15:08.151 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.151 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.153 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:vfdb
Sep-20 13:15:08.153 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.153 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.155 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:victors
Sep-20 13:15:08.156 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.156 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.158 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:phast
Sep-20 13:15:08.159 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.159 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.163 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:phigaro
Sep-20 13:15:08.163 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.163 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.166 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:phispy
Sep-20 13:15:08.166 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.166 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.170 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:iceberg
Sep-20 13:15:08.170 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.170 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.175 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:amrfinder
Sep-20 13:15:08.175 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.175 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.181 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:card_rgi
Sep-20 13:15:08.182 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.182 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.185 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:argminer
Sep-20 13:15:08.185 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.185 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.188 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:resfinder
Sep-20 13:15:08.188 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.188 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.191 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:refseq_masher
Sep-20 13:15:08.191 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.191 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.204 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:digis
Sep-20 13:15:08.205 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.205 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.221 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:renv` matches label `renv` for process with name bacannot_nf:merge_annotations
Sep-20 13:15:08.221 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.222 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.225 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:draw_GIs
Sep-20 13:15:08.225 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.225 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.228 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:main` matches label `main` for process with name bacannot_nf:gff2gbk
Sep-20 13:15:08.228 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.228 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.233 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:renv` matches label `renv` for process with name bacannot_nf:create_sql
Sep-20 13:15:08.233 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.233 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.239 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:jbrowse` matches label `jbrowse` for process with name bacannot_nf:jbrowse
Sep-20 13:15:08.239 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.240 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.247 [main] DEBUG nextflow.script.ProcessConfig - Config settings `withLabel:renv` matches label `renv` for process with name bacannot_nf:report
Sep-20 13:15:08.247 [main] DEBUG nextflow.executor.ExecutorFactory - << taskConfig executor: local
Sep-20 13:15:08.247 [main] DEBUG nextflow.executor.ExecutorFactory - >> processorType: 'local'
Sep-20 13:15:08.249 [main] DEBUG nextflow.extension.CH - Bridging dataflow queue=DataflowQueue(queue=[])
Sep-20 13:15:08.251 [main] DEBUG nextflow.extension.CH - Bridging dataflow queue=DataflowQueue(queue=[])
Sep-20 13:15:08.251 [main] DEBUG nextflow.Session - Ignite dataflow network (33)
Sep-20 13:15:08.256 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:prokka
Sep-20 13:15:08.257 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:mlst
Sep-20 13:15:08.257 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:barrnap
Sep-20 13:15:08.257 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:compute_gc
Sep-20 13:15:08.257 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:kofamscan
Sep-20 13:15:08.258 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:kegg_decoder
Sep-20 13:15:08.259 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:plasmidfinder
Sep-20 13:15:08.260 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:platon
Sep-20 13:15:08.260 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:find_GIs
Sep-20 13:15:08.260 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:vfdb
Sep-20 13:15:08.261 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:victors
Sep-20 13:15:08.261 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:phast
Sep-20 13:15:08.261 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:phigaro
Sep-20 13:15:08.261 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:phispy
Sep-20 13:15:08.261 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:iceberg
Sep-20 13:15:08.261 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:amrfinder
Sep-20 13:15:08.261 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:card_rgi
Sep-20 13:15:08.261 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:argminer
Sep-20 13:15:08.262 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:resfinder
Sep-20 13:15:08.262 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:refseq_masher
Sep-20 13:15:08.262 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:digis
Sep-20 13:15:08.262 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:merge_annotations
Sep-20 13:15:08.262 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:draw_GIs
Sep-20 13:15:08.262 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:gff2gbk
Sep-20 13:15:08.262 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:create_sql
Sep-20 13:15:08.263 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:jbrowse
Sep-20 13:15:08.263 [main] DEBUG nextflow.processor.TaskProcessor - Starting process > bacannot_nf:report
Sep-20 13:15:08.263 [main] DEBUG nextflow.script.ScriptRunner - > Await termination
Sep-20 13:15:08.263 [main] DEBUG nextflow.Session - Session await
Sep-20 13:15:08.375 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Sep-20 13:15:08.379 [Task submitter] INFO nextflow.Session - [0e/b22893] Submitted process > bacannot_nf:prokka (Executing generic annotation with Prokka)
Sep-20 13:20:08.259 [Task monitor] DEBUG n.processor.TaskPollingMonitor - !! executor local > tasks to be completed: 1 -- submitted tasks are shown below
~> TaskHandler[id: 1; name: bacannot_nf:prokka (Executing generic annotation with Prokka); status: RUNNING; exit: -; error: -; workDir: /home/david/work/WGS/4_genomes/work/0e/b22893f595f59c632b8e9b5cc2767c]
Sep-20 13:24:39.010 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 1; name: bacannot_nf:prokka (Executing generic annotation with Prokka); status: COMPLETED; exit: 0; error: -; workDir: /home/david/work/WGS/4_genomes/work/0e/b22893f595f59c632b8e9b5cc2767c]
Sep-20 13:24:39.034 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Sep-20 13:24:39.034 [Task submitter] INFO nextflow.Session - [02/79c569] Submitted process > bacannot_nf:find_GIs (Predicting Genomic Islands with IslandPath-DIMOB)
Sep-20 13:24:39.035 [Task monitor] DEBUG n.util.BlockingThreadExecutorFactory - Thread pool name=FileTransfer; maxThreads=72; maxQueueSize=216; keepAlive=1m
Sep-20 13:25:05.188 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 2; name: bacannot_nf:find_GIs (Predicting Genomic Islands with IslandPath-DIMOB); status: COMPLETED; exit: 0; error: -; workDir: /home/david/work/WGS/4_genomes/work/02/79c569ac2717482a99ffbfac4b49b0]
Sep-20 13:25:05.193 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Sep-20 13:25:05.194 [Task submitter] INFO nextflow.Session - [7b/c98ffd] Submitted process > bacannot_nf:refseq_masher (Scanning Refseq with mash)
Sep-20 13:25:08.289 [Task monitor] DEBUG n.processor.TaskPollingMonitor - !! executor local > tasks to be completed: 1 -- submitted tasks are shown below
~> TaskHandler[id: 3; name: bacannot_nf:refseq_masher (Scanning Refseq with mash); status: RUNNING; exit: -; error: -; workDir: /home/david/work/WGS/4_genomes/work/7b/c98ffd27f53529c4b5b46221b57a7e]
Sep-20 13:25:12.443 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 3; name: bacannot_nf:refseq_masher (Scanning Refseq with mash); status: COMPLETED; exit: 0; error: -; workDir: /home/david/work/WGS/4_genomes/work/7b/c98ffd27f53529c4b5b46221b57a7e]
Sep-20 13:25:12.447 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Sep-20 13:25:12.448 [Task submitter] INFO nextflow.Session - [22/96a15c] Submitted process > bacannot_nf:mlst (Performing MLST analysis with mlst pipeline from T. Seeman)
Sep-20 13:25:15.864 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 7; name: bacannot_nf:mlst (Performing MLST analysis with mlst pipeline from T. Seeman); status: COMPLETED; exit: 0; error: -; workDir: /home/david/work/WGS/4_genomes/work/22/96a15c3704287a1f0463fdbca3f70b]
Sep-20 13:25:15.870 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Sep-20 13:25:15.870 [Task submitter] INFO nextflow.Session - [a9/b7245f] Submitted process > bacannot_nf:barrnap (Predicting rRNA sequences with barrnap pipeline from T. Seeman)
Sep-20 13:25:19.616 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 6; name: bacannot_nf:barrnap (Predicting rRNA sequences with barrnap pipeline from T. Seeman); status: COMPLETED; exit: 0; error: -; workDir: /home/david/work/WGS/4_genomes/work/a9/b7245fdbcbdf9ac2e64251eefe372a]
Sep-20 13:25:19.621 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Sep-20 13:25:19.621 [Task submitter] INFO nextflow.Session - [61/255bdc] Submitted process > bacannot_nf:phigaro (Scanning putative prophage sequences with phigaro)
Sep-20 13:27:51.232 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 9; name: bacannot_nf:phigaro (Scanning putative prophage sequences with phigaro); status: COMPLETED; exit: 0; error: -; workDir: /home/david/work/WGS/4_genomes/work/61/255bdc44992a7728f457a49ae016e3]
Sep-20 13:27:51.237 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Sep-20 13:27:51.237 [Task submitter] INFO nextflow.Session - [c9/6d6818] Submitted process > bacannot_nf:digis (Scanning for Insertion Sequences with digIS)
Sep-20 13:29:39.255 [Task submitter] DEBUG n.processor.TaskPollingMonitor - %% executor local > tasks in the submission queue: 13 -- tasks to be submitted are shown below
~> TaskHandler[id: 4; name: bacannot_nf:phispy (Detecting prophages with PhiSpy); status: NEW; exit: -; error: -; workDir: /home/david/work/WGS/4_genomes/work/40/9214116335a66e67c11740de19085e]
~> TaskHandler[id: 5; name: bacannot_nf:platon (Detecting plasmid contigs with platon); status: NEW; exit: -; error: -; workDir: /home/david/work/WGS/4_genomes/work/00/562e82f297f48d3bcd36c23bd21757]
~> TaskHandler[id: 11; name: bacannot_nf:compute_gc (Calculating genome GC with bedtools); status: NEW; exit: -; error: -; workDir: /home/david/work/WGS/4_genomes/work/f6/3fb0ddd491ce20613c8bc042ab7e93]
~> TaskHandler[id: 16; name: bacannot_nf:kofamscan (Executing KOfamscan - Its outputs can be viewed in KEGG-mapper); status: NEW; exit: -; error: -; workDir: /home/david/work/WGS/4_genomes/work/8a/6e6853cdbf104da1ff706fba74d153]
~> TaskHandler[id: 15; name: bacannot_nf:card_rgi (Scanning AMR genes with RGI); status: NEW; exit: -; error: -; workDir: /home/david/work/WGS/4_genomes/work/85/ddee71a50b83f5556762d72cd570dd]
~> TaskHandler[id: 10; name: bacannot_nf:plasmidfinder (Detecting plasmids with plasmidfinder); status: NEW; exit: -; error: -; workDir: /home/david/work/WGS/4_genomes/work/3b/3f3b297381f5155d3c4b67ab87de28]
~> TaskHandler[id: 18; name: bacannot_nf:vfdb (Scanning virulence genes with VFDB); status: NEW; exit: -; error: -; workDir: /home/david/work/WGS/4_genomes/work/5c/3cdb20a7f09dbbd9ce459d7d5e039b]
~> TaskHandler[id: 20; name: bacannot_nf:phast (Annotating prophage genes with PHAST database); status: NEW; exit: -; error: -; workDir: /home/david/work/WGS/4_genomes/work/93/1bb00fcfafbfc17da224023366712c]
~> TaskHandler[id: 17; name: bacannot_nf:iceberg (Scanning for ICE genes with ICEberg database); status: NEW; exit: -; error: -; workDir: /home/david/work/WGS/4_genomes/work/47/541d03ba97d498d0056ee5eaf58bfa]
~> TaskHandler[id: 8; name: bacannot_nf:resfinder (Scanning AMR genes with resfinder); status: NEW; exit: -; error: -; workDir: /home/david/work/WGS/4_genomes/work/f8/bdcd7ef9b4cf425061dfea4463b401]
.. remaining tasks omitted.
Sep-20 13:30:08.350 [Task monitor] DEBUG n.processor.TaskPollingMonitor - !! executor local > tasks to be completed: 1 -- submitted tasks are shown below
~> TaskHandler[id: 12; name: bacannot_nf:digis (Scanning for Insertion Sequences with digIS); status: RUNNING; exit: -; error: -; workDir: /home/david/work/WGS/4_genomes/work/c9/6d681841624e28e3010547c91b0252]
Sep-20 13:31:14.331 [Task monitor] DEBUG n.processor.TaskPollingMonitor - Task completed > TaskHandler[id: 12; name: bacannot_nf:digis (Scanning for Insertion Sequences with digIS); status: COMPLETED; exit: 1; error: -; workDir: /home/david/work/WGS/4_genomes/work/c9/6d681841624e28e3010547c91b0252]
Sep-20 13:31:14.336 [Task submitter] DEBUG nextflow.executor.LocalTaskHandler - Launch cmd line: /bin/bash -ue .command.run
Sep-20 13:31:14.336 [Task submitter] INFO nextflow.Session - [40/921411] Submitted process > bacannot_nf:phispy (Detecting prophages with PhiSpy)
Sep-20 13:31:14.355 [Task monitor] ERROR nextflow.processor.TaskProcessor - Error executing process > 'bacannot_nf:digis (Scanning for Insertion Sequences with digIS)'
Caused by:
Process `bacannot_nf:digis (Scanning for Insertion Sequences with digIS)` terminated with an error exit status (1)
Command executed:
# activate env
source activate digIS ;
# run digIS
python3 /work/digIS/digIS_search.py -i strain_4782.fna -g strain_4782.gbk -o digIS
# parse digIS to get nucleotide and aminoacide
# also put ids in uppercase
# required for annotation merging and sqldb
conda deactivate ;
mkdir -p digIS/results/fastas ;
sed -e 's/id=/ID=/g' digIS/results/strain_4782.gff > strain_4782.gff ;
gff-toolbox convert -i strain_4782.gff -f fasta-nt --fasta strain_4782.fna --fasta_features transposable_element > digIS/results/fastas/strain_4782_is.fa ;
gff-toolbox convert -i strain_4782.gff -f fasta-aa --fasta strain_4782.fna --fasta_features transposable_element > digIS/results/fastas/strain_4782_is.faa ;
Command exit status:
1
Command output:
Filtering hits by cut off thresholds.
Filtering hits shorter or equal than 150 bp
Classification with GenBank annotation...
===== Processing of contig00072 sequence =====
Seed search...
Parsing Hmmer outputs...
Filtering hits with e-value higher than 0.001.
Seed Merging...
Number of records before merging: 1.
Number of records after merging: 1.
Seed Extension...
Filtering hits by cut off thresholds.
Filtering hits shorter or equal than 150 bp
Classification with GenBank annotation...
===== Processing of contig00073 sequence =====
Seed search...
Parsing Hmmer outputs...
Filtering hits with e-value higher than 0.001.
Seed Merging...
Number of records before merging: 0.
Number of records after merging: 0.
Seed Extension...
Filtering hits by cut off thresholds.
Filtering hits shorter or equal than 150 bp
Classification with GenBank annotation...
===== Processing of contig00074 sequence =====
Seed search...
Parsing Hmmer outputs...
Filtering hits with e-value higher than 0.001.
Seed Merging...
Number of records before merging: 0.
Number of records after merging: 0.
Seed Extension...
Filtering hits by cut off thresholds.
Filtering hits shorter or equal than 150 bp
Classification with GenBank annotation...
===== Processing of contig00075 sequence =====
Seed search...
Parsing Hmmer outputs...
Filtering hits with e-value higher than 0.001.
Seed Merging...
Number of records before merging: 0.
Number of records after merging: 0.
Seed Extension...
Filtering hits by cut off thresholds.
Filtering hits shorter or equal than 150 bp
Classification with GenBank annotation...
===== Processing of contig00076 sequence =====
Seed search...
Parsing Hmmer outputs...
Command error:
Traceback (most recent call last):
File "/work/digIS/digIS_search.py", line 26, in <module>
digIS.run()
File "/work/digIS/src/search_tool/digISMultifasta.py", line 23, in run
digIS_rec.run(search=search)
File "/work/digIS/src/search_tool/digIS.py", line 313, in run
self.parse()
File "/work/digIS/src/search_tool/digIS.py", line 57, in parse
self.parse_hmmer_output('model', self.hmmsearch_output)
File "/work/digIS/src/search_tool/digIS.py", line 71, in parse_hmmer_output
"chr", self.genome.seq, self.genome.length))
File "/work/digIS/src/search_tool/RecordDigIS.py", line 31, in from_hmmer
return cls(genome_name, chrom, genome_seq, seq_len, hsp.qid, sid, hsp.qstart, hsp.qend, start, end, strand, float(hsp.acc), float(hsp.dom_bitscore), float(hsp.dom_evalue))
File "/work/digIS/src/search_tool/RecordDigIS.py", line 13, in __init__
super().__init__(genome_name, chrom, start, end, strand, genome_seq, genome_len)
File "/work/digIS/src/common/grange.py", line 13, in __init__
raise ValueError("GRange: start or end position is out of the range.")
ValueError: GRange: start or end position is out of the range.
Work dir:
/home/david/work/WGS/4_genomes/work/c9/6d681841624e28e3010547c91b0252
Tip: when you have fixed the problem you can continue the execution adding the option `-resume` to the run command line
Sep-20 13:31:14.359 [Task monitor] DEBUG nextflow.Session - Session aborted -- Cause: Process `bacannot_nf:digis (Scanning for Insertion Sequences with digIS)` terminated with an error exit status (1)
Sep-20 13:31:14.374 [Task monitor] DEBUG nextflow.Session - The following nodes are still active:
[process] bacannot_nf:kegg_decoder
status=ACTIVE
port 0: (queue) OPEN ; channel: -
port 1: (cntrl) - ; channel: $
[process] bacannot_nf:merge_annotations
status=ACTIVE
port 0: (queue) OPEN ; channel: -
port 1: (cntrl) - ; channel: $
[process] bacannot_nf:draw_GIs
status=ACTIVE
port 0: (queue) OPEN ; channel: -
port 1: (cntrl) - ; channel: $
[process] bacannot_nf:gff2gbk
status=ACTIVE
port 0: (queue) OPEN ; channel: -
port 1: (cntrl) - ; channel: $
[process] bacannot_nf:create_sql
status=ACTIVE
port 0: (queue) OPEN ; channel: -
port 1: (cntrl) - ; channel: $
[process] bacannot_nf:jbrowse
status=ACTIVE
port 0: (queue) OPEN ; channel: -
port 1: (cntrl) - ; channel: $
[process] bacannot_nf:report
status=ACTIVE
port 0: (queue) OPEN ; channel: -
port 1: (cntrl) - ; channel: $
Sep-20 13:31:14.377 [main] DEBUG nextflow.Session - Session await > all process finished
Sep-20 13:31:14.377 [main] DEBUG nextflow.Session - Session await > all barriers passed
Sep-20 13:31:14.383 [main] INFO nextflow.script.BaseScript -
Sep-20 13:31:14.383 [main] INFO nextflow.script.BaseScript - Pipeline completed at: 2021-09-20T13:31:14.377Z
Sep-20 13:31:14.383 [main] INFO nextflow.script.BaseScript - Execution status: failed
Sep-20 13:31:14.383 [main] INFO nextflow.script.BaseScript - Execution duration: 16m 9s
Sep-20 13:31:14.383 [main] INFO nextflow.script.BaseScript - Thank you for using fmalmeida/bacannot pipeline!
Sep-20 13:31:14.385 [main] WARN n.processor.TaskPollingMonitor - Killing pending tasks (1)
Sep-20 13:31:14.398 [main] DEBUG nextflow.trace.WorkflowStatsObserver - Workflow completed > WorkflowStats[succeededCount=6; failedCount=1; ignoredCount=0; cachedCount=0; pendingCount=12; submittedCount=1; runningCount=-1; retriesCount=0; abortedCount=1; succeedDuration=12m 31s; failedDuration=3m 23s; cachedDuration=0ms;loadCpus=-1; loadMemory=0; peakRunning=1; peakCpus=1; peakMemory=0; ]
Sep-20 13:31:14.572 [main] DEBUG nextflow.CacheDB - Closing CacheDB done
Sep-20 13:31:14.592 [main] DEBUG nextflow.script.ScriptRunner - > Execution complete -- Goodbye
Hmmer seems ok now with Contig00076
In the hmmer folder there is no log in the logs folder for Contig00076 (the last log is for Contig00075)
Hi @davidvilanova,
Indeed, nothing seems wrong with the pipeline itself.
It seems that digIS is having problems while parsing the phmmer output, which has no hits.
I will have to check whether one of the other versions of this specific tool is able to correctly parse blank results. If not, I will open an issue in their repository and try to solve with them.
However, I must have this "problematic" sequence so I can test other versions and figure out the best solution.
I know that share the whole genome would be a problem. But, how about just a few contigs?
Let's say, the contigs 74 to 77. So I can have 3 contigs that runs well, and this 76 that raises the error?
Would it be ok to send me the sequeno of these contigs so I can make some tests?
If it is ok, you can send me to "almeidafmarques@gmail.com"
Felipe.
Done !!!
Thank you!
I will try to find a solution for the problem and I let you know as soon as I have an update on the case.
Hi @davidvilanova,
As I told you last week, I have commented about this issue in digIS repository since this error is related to the tool itself and not to the pipeline. However, while looking at his scripts and playing with the contigs you've provided, I believe I found the source of the error.
Therefore, until we wait for the new release of digIS which may solve this bug, I have updated the docker image to contain the unofficial solution that I've come up with.
Please, update both the pipeline and the docker image, give it a try and let me know what happens
docker pull fmalmeida/bacannot:v2.3
docker pull fmalmeida/bacannot:v2.3_renv # please also update this one because I updated one report.
nextflow pull fmalmeida/bacannot
I have seen in the nextflow.log that you have executed the following:
nextflow run fmalmeida/bacannot --prefix strain_4782 --genome ASSEMBLY_4782/2021-4782_TTAGGC-JRDKK_L001_R/shortreads_only/shovill/shovill_assembly.fasta --outdir ANNOTATION_4782 --threads 16 --resfinder_species 'Haemophilus parasuis'
Although the command line its fine, the --resfinder_species
is being used wrongly. As discussed in the documentation, this parameter must be used with one of the available resfinder species panels. The available species panels can be checked directly in their main page when you click "Select Species".
That being said, the species 'Haemophilus parasuis' is not an option for Resfinder. Therefore, to work correctly, instead of using --resfinder_species 'Haemophilus parasuis'
you must use --resfinder_species 'Other'
.
๐
Hi @fmalmeida
Seems to work !!!
๐ great news.
I will then close this issue. Few free to reopen it or open a new one in case of something new.
As soon as an official big fix is released by digIS I will update the images.
Regards,
Felipe.
Hi @fmalmeida
The problem is back again.
[- ] process > bacannot_nf:report -
Error executing process > 'bacannot_nf:digis (Scanning for Insertion Sequences with digIS)'
Caused by:
Process `bacannot_nf:digis (Scanning for Insertion Sequences with digIS)` terminated with an error exit status (1)
Command executed:
# activate env
source activate digIS ;
# run digIS
python3 /work/digIS/digIS_search.py -i strain_2.fna -g strain_2.gbk -o digIS
# parse digIS to get nucleotide and aminoacide
# also put ids in uppercase
# required for annotation merging and sqldb
conda deactivate ;
mkdir -p digIS/results/fastas ;
sed -e 's/id=/ID=/g' digIS/results/strain_2.gff > strain_2.gff ;
gff-toolbox convert -i strain_2.gff -f fasta-nt --fasta strain_2.fna --fasta_features transposable_element > digIS/results/fastas/strain_2_is.fa ;
gff-toolbox convert -i strain_2.gff -f fasta-aa --fasta strain_2.fna --fasta_features transposable_element > digIS/results/fastas/strain_2_is.faa ;
Command exit status:
1
Command output:
Filtering hits by cut off thresholds.
Filtering hits shorter or equal than 150 bp
Classification with GenBank annotation...
===== Processing of k141_812 sequence =====
Seed search...
Parsing Hmmer outputs...
Filtering hits with e-value higher than 0.001.
Seed Merging...
Number of records before merging: 0.
Number of records after merging: 0.
Seed Extension...
Filtering hits by cut off thresholds.
Filtering hits shorter or equal than 150 bp
Classification with GenBank annotation...
===== Processing of k141_814 sequence =====
Seed search...
Parsing Hmmer outputs...
Filtering hits with e-value higher than 0.001.
Seed Merging...
Number of records before merging: 0.
Number of records after merging: 0.
Seed Extension...
Filtering hits by cut off thresholds.
Filtering hits shorter or equal than 150 bp
Classification with GenBank annotation...
===== Processing of k141_816 sequence =====
Seed search...
Parsing Hmmer outputs...
Filtering hits with e-value higher than 0.001.
Seed Merging...
Number of records before merging: 1.
Number of records after merging: 1.
Seed Extension...
Filtering hits by cut off thresholds.
Filtering hits shorter or equal than 150 bp
Classification with GenBank annotation...
===== Processing of k141_1154 sequence =====
Seed search...
Parsing Hmmer outputs...
Filtering hits with e-value higher than 0.001.
Seed Merging...
Number of records before merging: 0.
Number of records after merging: 0.
Seed Extension...
Filtering hits by cut off thresholds.
Filtering hits shorter or equal than 150 bp
Classification with GenBank annotation...
===== Processing of k141_1155 sequence =====
Seed search...
Parsing Hmmer outputs...
Iยดm up to date with iamges and code. I guess hmmer is failing again with another contig
โ ``` 4_genomes docker pull fmalmeida/bacannot:v2.3
v2.3: Pulling from fmalmeida/bacannot Digest: sha256:36fb290acba9c5dc9e621900c11e8f733b1e8b1205c9d5f74a2d579c24218490 Status: Image is up to date for fmalmeida/bacannot:v2.3 docker.io/fmalmeida/bacannot:v2.3 โ 4_genomes docker pull fmalmeida/bacannot:v2.3_renv v2.3_renv: Pulling from fmalmeida/bacannot Digest: sha256:bf7850807d6edb8fe820d4b9c5963ba941c6873f7fa0676f20ffcd6c1c154d5d Status: Image is up to date for fmalmeida/bacannot:v2.3_renv docker.io/fmalmeida/bacannot:v2.3_renv โ 4_genomes nextflow pull fmalmeida/bacannot
Checking fmalmeida/bacannot ... Already-up-to-date - revision: 528cb873ff [master] โ 4_genomes
Here is the contig:
k141_1155 flag=0 multi=1.7411 len=477 TTGCCGTTTCAATATCCCAAAAACAGCCACTTTTCCTGCTGCTCCACGACCTCGTTTTCCTTTACGAGGTCCACCAAAATAGCTTTCATCCAACTCAATTTGTCCGTCAAATACTTCATCTGCTTCAAGGGCTAAATGATAACTGATGACCTCACGGATTTTTCGGTAAAACAGGATCGCTGAATTGGGCTGAATACCTAGCAAATCTGCGACTGATCGAGCTGTTACTTCTAACACAAAAAATTCAAGGAGTTTCTTCTGTATAGATTTCTTTAATTTACAATGAGTTATCTTCATTTTTGTAGGTTAGCATACTAGCTAATCTACGTCAGCCCCTAAATCTTTCATCAAACCACGTCTACCATCACAGGTAATCGATTGAATTATATAGCCTTTTTCTCTTAACCTATTCAGGGCAAGTTTGTAGTAAATATCTTTTTCGGTTCGCACAAAGTAATGTGAAATCACATTATTTGA
Hi @davidvilanova,
I have already sent this to the digIS developers.
In the mean time I will try to find a custom fix for it.
And also, try to quickly implement a parameter to enable users to skip this step if necessary.
In any case, I will let you know as soon as I have any updates!
Felipe :)
Hi @davidvilanova,
I took a quick look and it really was simple. The problem was that digIS was trying to load the start positions as a negative value ... which is incorrect. I made a quick fix to transform the start to 0 when a negative appears. I also warned the developers.
Please update the fmalmeida/bacannot:v2.3
image and try again. It will probably work.
Please let me know.
๐
Hi @fmalmeida That has corrected the problem. Everything ok. Will let you know if i come across the problem again.
Thanks !!!
Hi , I get the following error ๐ `Error executing process > 'bacannot_nf:digis (Scanning for Insertion Sequences with digIS)'
See shot below: `![image](https://user-images.githubusercontent.com/11404840/133981596-a3c619f4-6cf9-4470-877f-81d357a9a094.png)
Contig00076 that seems to cause the problem is 274nt long.
Whatยดs wrong ?