I was trying to reproduce some of the analysis of your paper, particularly on the visium dataset, but I am struggling a bit.
For now I have only tried one slide (GSM4644079).
The challenges I am facing:
After running spaceranger and inspecting the output bam file, I noticed some reads with downstream sequence = CTTTAAGACCAATGACTTA gets aligned to chrH2B-EGFP-N some don't.
As a result when running trex run10x it only finds 56 barcodes.
Furthermore some barcodes are clearly a substring of others e.g. AGATTCTATAAACT----------------AGATTCTATAAACTGTGCGGTCACTCTCGT
Lastly both aligned and unaligned reads shows TTCTATAAACTGTGCGG as constant region upstream the 30bp of the barcode. whereas in your reference you have CAAGTAAATGCA
Additionally if I run trex with auto detection it raises:
line 274, in detect_clone_id_location
raise ValueError(
ValueError: Could not detect cloneID location on chromosome chrH2B-EGFP-N
Right now I am running with
trex run10x slide1bam/ --visium -o trex_output_2/ --start 1122 --end 1151 according to #1
Bam file used for trex using spaceranger 3.0.0
Could you clarify the expected upstream and downstream constants of the construct, and if the reference in the GitHub folder is the right one to use?
Hi Team,
Thanks for the nice work.
I was trying to reproduce some of the analysis of your paper, particularly on the visium dataset, but I am struggling a bit. For now I have only tried one slide (GSM4644079).
The challenges I am facing:
CTTTAAGACCAATGACTTA
gets aligned tochrH2B-EGFP-N
some don't.trex run10x
it only finds 56 barcodes.AGATTCTATAAACT----------------
AGATTCTATAAACTGTGCGGTCACTCTCGT
TTCTATAAACTGTGCGG
as constant region upstream the 30bp of the barcode. whereas in your reference you haveCAAGTAAATGCA
Additionally if I run trex with auto detection it raises:
Right now I am running with
trex run10x slide1bam/ --visium -o trex_output_2/ --start 1122 --end 1151
according to #1 Bam file used for trex usingspaceranger 3.0.0
Could you clarify the expected upstream and downstream constants of the construct, and if the reference in the GitHub folder is the right one to use?
Any help is appreciated. Thank you.