search

galaxyproject / dunovo

Reference-free duplex sequencing pipeline.
Other
18 stars 6 forks source link

Printing empty consensus reads #16

Closed NickSto closed 6 years ago

NickSto commented 6 years ago

For some garbage raw reads, one or both single strand consensus sequences may be so full of N's that the resulting duplex consensus contains no valid bases.

We should omit empty consensus reads.

NickSto commented 6 years ago

Note to self: this happened in family CACTTGTTTTTACCCACCCCAACC in turbido/run6/R1S2/duplex_1.fq, but not in run5. Looks like it's probably from a garbage alignment (ba.2 at least) that wouldn't produce any good consensus. It probably didn't happen in run5 because the weaker barcode error correction resulted in a small family that didn't pass the 3 read threshold.

NickSto commented 6 years ago

Fixed in 70dc383.