github-actions[bot]
commented
2 months ago Test Results (powered by Planemo)
Test Summary
| Test State | Count |
|---|---|
| Total | 1 |
| Passed | 0 |
| Error | 1 |
| Failure | 0 |
| Skipped | 0 |
Errored Tests
*❌ pe-artic-variation.ga_0
**Execution Problem:**
* ```
Failed to run workflow, at least one job is in [error] state.
```
#### Workflow invocation details
* Invocation Messages
*
Steps
- **Step 1: Paired Collection**: * step_state: scheduled - **Step 2: NC_045512.2 FASTA sequence of SARS-CoV-2**: * step_state: scheduled - **Step 11: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**: * step_state: scheduled *Jobs
- **Job 1:** * Job state is ok **Command Line:** * ```console cd ../; python _evaluate_expression_.py ``` **Exit Code:** * ```console 0 ``` **Traceback:** * ```console ``` **Job Parameters:** * | Job parameter | Parameter value | | ------------- | --------------- | | \_\_input\_ext | ` "input" ` | | \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` | | chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` | | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "( DP > ", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1", "select_param_type": "integer"}}, {"__index__": 2, "param_type": {"__current_case__": 0, "component_value": " ) & ( ( AF * DP ) >= ( ", "select_param_type": "text"}}, {"__index__": 3, "param_type": {"__current_case__": 1, "component_value": "10", "select_param_type": "integer"}}, {"__index__": 4, "param_type": {"__current_case__": 0, "component_value": " - 0.5 ) )", "select_param_type": "text"}}] ` | | dbkey | ` "?" ` | - **Step 12: toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa\_mem/0.7.18**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
set -o | grep -q pipefail && set -o pipefail; ln -s '/tmp/tmp1okvltvi/files/9/5/8/dataset_958a6cea-41ce-427c-b0a9-c563c2fa5359.dat' 'localref.fa' && bwa index 'localref.fa' && bwa mem -t "${GALAXY_SLOTS:-1}" -v 1 'localref.fa' '/tmp/tmp1okvltvi/files/5/f/0/dataset_5f0f0c49-fea0-4cc5-98ab-00106f0ec2a2.dat' '/tmp/tmp1okvltvi/files/b/4/2/dataset_b428099c-035d-4931-a09e-6062a17d8a72.dat' | samtools sort -@${GALAXY_SLOTS:-2} -T "${TMPDIR:-.}" -O bam -o '/tmp/tmp1okvltvi/job_working_directory/000/9/outputs/dataset_32553a94-a101-4fa1-817d-eb5c139fa0a2.dat'
```
**Exit Code:**
* ```console
0
```
**Standard Error:**
* ```console
[bwa_index] Pack FASTA... 0.00 sec
[bwa_index] Construct BWT for the packed sequence...
[bwa_index] 0.00 seconds elapse.
[bwa_index] Update BWT... 0.00 sec
[bwa_index] Pack forward-only FASTA... 0.00 sec
[bwa_index] Construct SA from BWT and Occ... 0.00 sec
[main] Version: 0.7.18-r1243-dirty
[main] CMD: bwa index localref.fa
[main] Real time: 0.013 sec; CPU: 0.008 sec
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (188, 240, 293)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 503)
[M::mem_pestat] mean and std.dev: (236.09, 72.41)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 608)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (188, 239, 293)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 503)
[M::mem_pestat] mean and std.dev: (235.71, 72.44)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 608)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (186, 239, 293)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 507)
[M::mem_pestat] mean and std.dev: (235.25, 72.64)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 614)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (187, 240, 293)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 505)
[M::mem_pestat] mean and std.dev: (235.77, 72.25)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 611)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (186, 238, 292)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 504)
[M::mem_pestat] mean and std.dev: (234.79, 72.73)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 610)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (185, 238, 292)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (1, 506)
[M::mem_pestat] mean and std.dev: (234.12, 72.68)
[M::mem_pestat] low and high boundaries for proper pairs: (1, 613)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[main] Version: 0.7.18-r1243-dirty
[main] CMD: bwa mem -t 1 -v 1 localref.fa /tmp/tmp1okvltvi/files/5/f/0/dataset_5f0f0c49-fea0-4cc5-98ab-00106f0ec2a2.dat /tmp/tmp1okvltvi/files/b/4/2/dataset_b428099c-035d-4931-a09e-6062a17d8a72.dat
[main] Real time: 10.544 sec; CPU: 10.249 sec
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| analysis\_type | ` {"__current_case__": 0, "analysis_type_selector": "illumina"} ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| fastq\_input | ` {"__current_case__": 2, "fastq_input1": {"values": [{"id": 4, "src": "dce"}]}, "fastq_input_selector": "paired_collection", "iset_stats": ""} ` |
| output\_sort | ` "coordinate" ` |
| reference\_source | ` {"__current_case__": 1, "index_a": "auto", "ref_file": {"values": [{"id": 1, "src": "hda"}]}, "reference_source_selector": "history"} ` |
| rg | ` {"__current_case__": 3, "rg_selector": "do_not_set"} ` |
</details>
- **Step 13: toolshed.g2.bx.psu.edu/repos/iuc/samtools\_view/samtools\_view/1.15.1+galaxy2**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) && addmemory=${GALAXY_MEMORY_MB_PER_SLOT:-768} && ((addmemory=addmemory*75/100)) && ln -s '/tmp/tmp1okvltvi/files/3/2/5/dataset_32553a94-a101-4fa1-817d-eb5c139fa0a2.dat' infile && ln -s '/tmp/tmp1okvltvi/files/_metadata_files/c/7/2/metadata_c7229e69-7252-4199-b128-3e4b3d8d20f1.dat' infile.bai && samtools view -@ $addthreads -b -q 20 -f 1 -F 268 -G 0 -o outfile infile
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| addref\_cond | ` {"__current_case__": 0, "addref_select": "no"} ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| mode | ` {"__current_case__": 1, "filter_config": {"cigarcons": null, "cond_region": {"__current_case__": 0, "select_region": "no"}, "cond_rg": {"__current_case__": 0, "select_rg": "no"}, "exclusive_filter": ["4", "8", "256"], "exclusive_filter_all": null, "inclusive_filter": ["1"], "library": "", "qname_file": null, "quality": "20", "tag": null}, "output_options": {"__current_case__": 0, "adv_output": {"collapsecigar": false, "readtags": []}, "complementary_output": false, "output_format": {"__current_case__": 2, "oformat": "bam"}, "reads_report_type": "retained"}, "outtype": "selected_reads", "subsample_config": {"subsampling_mode": {"__current_case__": 0, "factor": "1.0", "seed": null, "select_subsample": "fraction"}}} ` |
</details>
- **Step 14: toolshed.g2.bx.psu.edu/repos/iuc/lofreq\_viterbi/lofreq\_viterbi/2.1.5+galaxy0**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
ln -s '/tmp/tmp1okvltvi/files/9/5/8/dataset_958a6cea-41ce-427c-b0a9-c563c2fa5359.dat' reference.fa && lofreq faidx reference.fa 2>&1 || echo "Error running samtools faidx for indexing fasta reference for lofreq" >&2 && lofreq viterbi --ref 'reference.fa' --defqual 2 --out tmp.bam '/tmp/tmp1okvltvi/files/f/1/d/dataset_f1d5ba86-6de4-4ed2-8ddf-dd8c94e34f20.dat' && samtools sort --no-PG -T "${TMPDIR:-.}" -@ ${GALAXY_SLOTS:-1} -O BAM -o '/tmp/tmp1okvltvi/job_working_directory/000/11/outputs/dataset_afa04a34-7554-4779-8045-f384aa6b3139.dat' tmp.bam
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| adv\_options | ` {"bq2_handling": {"__current_case__": 0, "defqual": "2", "replace_bq2": "keep"}, "keepflags": false} ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| reference\_source | ` {"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"} ` |
</details>
- **Step 15: toolshed.g2.bx.psu.edu/repos/devteam/samtools\_stats/samtools\_stats/2.0.5**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) && ln -s '/tmp/tmp1okvltvi/files/f/1/d/dataset_f1d5ba86-6de4-4ed2-8ddf-dd8c94e34f20.dat' infile && ln -s '/tmp/tmp1okvltvi/files/_metadata_files/9/3/7/metadata_9374a21a-c424-4b24-90bb-4661cc7d468c.dat' infile.bai && samtools stats -@ $addthreads infile > '/tmp/tmp1okvltvi/job_working_directory/000/12/outputs/dataset_28a5c33b-8238-4767-bcab-30b50ffd6bae.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| addref\_cond | ` {"__current_case__": 0, "addref_select": "no"} ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| cond\_region | ` {"__current_case__": 0, "select_region": "no"} ` |
| cov\_threshold | ` None ` |
| coverage\_cond | ` {"__current_case__": 0, "coverage_select": "no"} ` |
| dbkey | ` "?" ` |
| filter\_by\_flags | ` {"__current_case__": 1, "filter_flags": "nofilter"} ` |
| gc\_depth | ` None ` |
| insert\_size | ` None ` |
| most\_inserts | ` None ` |
| read\_group | ` None ` |
| read\_length | ` None ` |
| remove\_dups | ` false ` |
| remove\_overlaps | ` false ` |
| sparse | ` false ` |
| split\_output\_cond | ` {"__current_case__": 0, "split_output_selector": "no"} ` |
| trim\_quality | ` None ` |
</details>
- **Step 16: toolshed.g2.bx.psu.edu/repos/iuc/lofreq\_indelqual/lofreq\_indelqual/2.1.5+galaxy1**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
ln -s '/tmp/tmp1okvltvi/files/9/5/8/dataset_958a6cea-41ce-427c-b0a9-c563c2fa5359.dat' reference.fa && lofreq faidx reference.fa 2>&1 || echo "Error running samtools faidx for indexing fasta reference for lofreq" >&2 && lofreq indelqual --dindel --ref reference.fa -o output.bam /tmp/tmp1okvltvi/files/a/f/a/dataset_afa04a34-7554-4779-8045-f384aa6b3139.dat
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| strategy | ` {"__current_case__": 1, "reference_source": {"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"}, "selector": "dindel"} ` |
</details>
- **Step 17: toolshed.g2.bx.psu.edu/repos/iuc/ivar\_trim/ivar\_trim/1.4.3+galaxy0**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
cp '/tmp/tmp1okvltvi/files/6/9/5/dataset_69570f6e-eb26-4ff2-b682-b5da8b8ad3e9.dat' bed.bed && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/a250929be21b/ivar_trim/sanitize_bed.py' bed.bed && ln -s '/tmp/tmp1okvltvi/files/4/7/f/dataset_47fa7230-6519-4bdf-a3a7-ccee61760f5a.dat' amplicon_info_raw.tsv && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_trim/a250929be21b/ivar_trim/prepare_amplicon_info.py' bed.bed amplicon_info_raw.tsv amplicon_info.tsv && ln -s '/tmp/tmp1okvltvi/files/d/6/7/dataset_d6754ca4-6087-4eed-b1a2-95a8e0dbb01f.dat' sorted.bam && ln -s '/tmp/tmp1okvltvi/files/_metadata_files/2/a/f/metadata_2afdb052-8617-4c01-920e-724ffe24b55a.dat' sorted.bam.bai && ivar trim -i sorted.bam -b bed.bed -f amplicon_info.tsv -x 0 -e -m -1 -q 0 -s 4 | samtools sort -@ ${GALAXY_SLOTS:-1} -T "${TMPDIR:-.}" -o trimmed.sorted.bam -
```
**Exit Code:**
* ```console
0
```
**Standard Error:**
* ```console
Found 218 primers in BED file
Amplicons detected:
[30, 410] max = 29866
[320, 726] max = 29866
[642, 1028] max = 29866
[943, 1337] max = 29866
[1242, 1651] max = 29866
[1573, 1964] max = 29866
[1868, 2269] max = 29866
[2181, 2592] max = 29866
[2504, 2904] max = 29866
[2826, 3210] max = 29866
[3144, 3531] max = 29866
[3460, 3853] max = 29866
[3771, 4164] max = 29866
[4044, 4450] max = 29866
[4294, 4696] max = 29866
[4636, 5017] max = 29866
[4939, 5321] max = 29866
[5230, 5644] max = 29866
[5563, 5957] max = 29866
[5867, 6272] max = 29866
[6167, 6550] max = 29866
[6466, 6873] max = 29866
[6718, 7117] max = 29866
[7035, 7415] max = 29866
[7305, 7694] max = 29866
[7626, 8019] max = 29866
[7943, 8341] max = 29866
[8249, 8661] max = 29866
[8595, 8983] max = 29866
[8888, 9271] max = 29866
[9204, 9585] max = 29866
[9477, 9858] max = 29866
[9784, 10171] max = 29866
[10076, 10459] max = 29866
[10362, 10763] max = 29866
[10666, 11074] max = 29866
[10999, 11394] max = 29866
[11306, 11693] max = 29866
[11555, 11949] max = 29866
[11863, 12256] max = 29866
[12110, 12490] max = 29866
[12417, 12802] max = 29866
[12710, 13096] max = 29866
[13005, 13400] max = 29866
[13307, 13699] max = 29866
[13599, 13984] max = 29866
[13918, 14299] max = 29866
[14207, 14601] max = 29866
[14545, 14926] max = 29866
[14865, 15246] max = 29866
[15171, 15560] max = 29866
[15481, 15886] max = 29866
[15827, 16209] max = 29866
[16118, 16510] max = 29866
[16416, 16833] max = 29866
[16748, 17152] max = 29866
[17065, 17452] max = 29866
[17381, 17761] max = 29866
[17674, 18062] max = 29866
[17966, 18348] max = 29866
[18253, 18672] max = 29866
[18596, 18979] max = 29866
[18896, 19297] max = 29866
[19204, 19616] max = 29866
[19548, 19939] max = 29866
[19844, 20255] max = 29866
[20172, 20572] max = 29866
[20472, 20890] max = 29866
[20786, 21169] max = 29866
[21075, 21455] max = 29866
[21357, 21743] max = 29866
[21658, 22038] max = 29866
[21961, 22346] max = 29866
[22262, 22650] max = 29866
[22516, 22903] max = 29866
[22797, 23214] max = 29866
[23122, 23522] max = 29866
[23443, 23847] max = 29866
[23789, 24169] max = 29866
[24078, 24467] max = 29866
[24391, 24789] max = 29866
[24696, 25076] max = 29866
[24978, 25369] max = 29866
[25279, 25673] max = 29866
[25601, 25994] max = 29866
[25902, 26315] max = 29866
[26197, 26590] max = 29866
[26520, 26913] max = 29866
[26835, 27227] max = 29866
[27141, 27533] max = 29866
[27446, 27854] max = 29866
[27784, 28172] max = 29866
[28081, 28464] max = 29866
[28394, 28779] max = 29866
[28677, 29063] max = 29866
[28985, 29378] max = 29866
[29288, 29693] max = 29866
[29486, 29866] max = 29866
Reading from sorted.bam
Minimum Read Length based on 1000 reads: 72
-------
Results:
Primer Name Read Count
nCoV-2019_1_LEFT 235
nCoV-2019_1_RIGHT 128
nCoV-2019_2_LEFT 20
nCoV-2019_2_RIGHT 48
nCoV-2019_3_LEFT 3882
nCoV-2019_3_RIGHT 5189
nCoV-2019_4_LEFT 8981
nCoV-2019_4_RIGHT 10479
nCoV-2019_5_LEFT 66
nCoV-2019_5_RIGHT 3
nCoV-2019_6_LEFT 0
nCoV-2019_6_RIGHT 2
nCoV-2019_7_LEFT 6
nCoV-2019_7_LEFT_alt0 0
nCoV-2019_7_RIGHT 0
nCoV-2019_7_RIGHT_alt5 7
nCoV-2019_8_LEFT 7
nCoV-2019_8_RIGHT 20
nCoV-2019_9_LEFT 23
nCoV-2019_9_LEFT_alt4 0
nCoV-2019_9_RIGHT 0
nCoV-2019_9_RIGHT_alt2 9
nCoV-2019_10_LEFT 55
nCoV-2019_10_RIGHT 30
nCoV-2019_11_LEFT 16
nCoV-2019_11_RIGHT 11
nCoV-2019_12_LEFT 7
nCoV-2019_12_RIGHT 2
nCoV-2019_13_LEFT 8
nCoV-2019_13_RIGHT 10
nCoV-2019_14_LEFT 7
nCoV-2019_14_LEFT_alt4 1
nCoV-2019_14_RIGHT 3
nCoV-2019_14_RIGHT_alt2 17
nCoV-2019_15_LEFT 0
nCoV-2019_15_LEFT_alt1 12
nCoV-2019_15_RIGHT 0
nCoV-2019_15_RIGHT_alt3 12
nCoV-2019_16_LEFT 80
nCoV-2019_16_RIGHT 29
nCoV-2019_17_LEFT 19
nCoV-2019_17_RIGHT 18
nCoV-2019_18_LEFT 0
nCoV-2019_18_LEFT_alt2 30
nCoV-2019_18_RIGHT 32
nCoV-2019_18_RIGHT_alt1 0
nCoV-2019_19_LEFT 5
nCoV-2019_19_RIGHT 5
nCoV-2019_20_LEFT 54
nCoV-2019_20_RIGHT 28
nCoV-2019_21_LEFT 0
nCoV-2019_21_LEFT_alt2 9
nCoV-2019_21_RIGHT 0
nCoV-2019_21_RIGHT_alt0 2
nCoV-2019_22_LEFT 77
nCoV-2019_22_RIGHT 54
nCoV-2019_23_LEFT 9
nCoV-2019_23_RIGHT 8
nCoV-2019_24_LEFT 62
nCoV-2019_24_RIGHT 17
nCoV-2019_25_LEFT 7
nCoV-2019_25_RIGHT 3
nCoV-2019_26_LEFT 33
nCoV-2019_26_RIGHT 25
nCoV-2019_27_LEFT 107
nCoV-2019_27_RIGHT 35
nCoV-2019_28_LEFT 13
nCoV-2019_28_RIGHT 38
nCoV-2019_29_LEFT 0
nCoV-2019_29_RIGHT 8
nCoV-2019_30_LEFT 11
nCoV-2019_30_RIGHT 22
nCoV-2019_31_LEFT 34
nCoV-2019_31_RIGHT 22
nCoV-2019_32_LEFT 26
nCoV-2019_32_RIGHT 10
nCoV-2019_33_LEFT 10
nCoV-2019_33_RIGHT 19
nCoV-2019_34_LEFT 48
nCoV-2019_34_RIGHT 53
nCoV-2019_35_LEFT 14
nCoV-2019_35_RIGHT 27
nCoV-2019_36_LEFT 17
nCoV-2019_36_RIGHT 27
nCoV-2019_37_LEFT 35
nCoV-2019_37_RIGHT 51
nCoV-2019_38_LEFT 20
nCoV-2019_38_RIGHT 22
nCoV-2019_39_LEFT 97
nCoV-2019_39_RIGHT 26
nCoV-2019_40_LEFT 23
nCoV-2019_40_RIGHT 17
nCoV-2019_41_LEFT 49
nCoV-2019_41_RIGHT 21
nCoV-2019_42_LEFT 1023
nCoV-2019_42_RIGHT 2409
nCoV-2019_43_LEFT 26
nCoV-2019_43_RIGHT 8
nCoV-2019_44_LEFT 0
nCoV-2019_44_LEFT_alt3 58
nCoV-2019_44_RIGHT 0
nCoV-2019_44_RIGHT_alt0 89
nCoV-2019_45_LEFT 3
nCoV-2019_45_LEFT_alt2 4
nCoV-2019_45_RIGHT 0
nCoV-2019_45_RIGHT_alt7 4
nCoV-2019_46_LEFT 0
nCoV-2019_46_LEFT_alt1 4
nCoV-2019_46_RIGHT 0
nCoV-2019_46_RIGHT_alt2 20
nCoV-2019_47_LEFT 33
nCoV-2019_47_RIGHT 22
nCoV-2019_48_LEFT 35
nCoV-2019_48_RIGHT 27
nCoV-2019_49_LEFT 48
nCoV-2019_49_RIGHT 44
nCoV-2019_50_LEFT 34
nCoV-2019_50_RIGHT 21
nCoV-2019_51_LEFT 25
nCoV-2019_51_RIGHT 17
nCoV-2019_52_LEFT 52
nCoV-2019_52_RIGHT 63
nCoV-2019_53_LEFT 26
nCoV-2019_53_RIGHT 23
nCoV-2019_54_LEFT 51
nCoV-2019_54_RIGHT 23
nCoV-2019_55_LEFT 77
nCoV-2019_55_RIGHT 84
nCoV-2019_56_LEFT 5
nCoV-2019_56_RIGHT 18
nCoV-2019_57_LEFT 84
nCoV-2019_57_RIGHT 72
nCoV-2019_58_LEFT 29
nCoV-2019_58_RIGHT 29
nCoV-2019_59_LEFT 8
nCoV-2019_59_RIGHT 2
nCoV-2019_60_LEFT 30
nCoV-2019_60_RIGHT 38
nCoV-2019_61_LEFT 34
nCoV-2019_61_RIGHT 42
nCoV-2019_62_LEFT 18
nCoV-2019_62_RIGHT 14
nCoV-2019_63_LEFT 35
nCoV-2019_63_RIGHT 36
nCoV-2019_64_LEFT 1
nCoV-2019_64_RIGHT 1
nCoV-2019_65_LEFT 31
nCoV-2019_65_RIGHT 61
nCoV-2019_66_LEFT 6
nCoV-2019_66_RIGHT 3
nCoV-2019_67_LEFT 910
nCoV-2019_67_RIGHT 503
nCoV-2019_68_LEFT 58
nCoV-2019_68_RIGHT 144
nCoV-2019_69_LEFT 7504
nCoV-2019_69_RIGHT 5814
nCoV-2019_70_LEFT 43
nCoV-2019_70_RIGHT 12
nCoV-2019_71_LEFT 451
nCoV-2019_71_RIGHT 630
nCoV-2019_72_LEFT 38
nCoV-2019_72_RIGHT 7
nCoV-2019_73_LEFT 91
nCoV-2019_73_RIGHT 58
nCoV-2019_74_LEFT 0
nCoV-2019_74_RIGHT 695
nCoV-2019_75_LEFT 10352
nCoV-2019_75_RIGHT 7650
nCoV-2019_76_LEFT 2
nCoV-2019_76_LEFT_alt3 97
nCoV-2019_76_RIGHT 18
nCoV-2019_76_RIGHT_alt0 44
nCoV-2019_77_LEFT 6745
nCoV-2019_77_RIGHT 12194
nCoV-2019_78_LEFT 93
nCoV-2019_78_RIGHT 10
nCoV-2019_79_LEFT 221
nCoV-2019_79_RIGHT 209
nCoV-2019_80_LEFT 18
nCoV-2019_80_RIGHT 6
nCoV-2019_81_LEFT 10
nCoV-2019_81_RIGHT 12
nCoV-2019_82_LEFT 24
nCoV-2019_82_RIGHT 13
nCoV-2019_83_LEFT 23
nCoV-2019_83_RIGHT 0
nCoV-2019_84_LEFT 16
nCoV-2019_84_RIGHT 18
nCoV-2019_85_LEFT 7
nCoV-2019_85_RIGHT 0
nCoV-2019_86_LEFT 24
nCoV-2019_86_RIGHT 45
nCoV-2019_87_LEFT 9
nCoV-2019_87_RIGHT 14
nCoV-2019_88_LEFT 20
nCoV-2019_88_RIGHT 36
nCoV-2019_89_LEFT 2
nCoV-2019_89_LEFT_alt2 6
nCoV-2019_89_RIGHT 0
nCoV-2019_89_RIGHT_alt4 13
nCoV-2019_90_LEFT 21
nCoV-2019_90_RIGHT 20
nCoV-2019_91_LEFT 41
nCoV-2019_91_RIGHT 24
nCoV-2019_92_LEFT 25
nCoV-2019_92_RIGHT 22
nCoV-2019_93_LEFT 33
nCoV-2019_93_RIGHT 38
nCoV-2019_94_LEFT 72
nCoV-2019_94_RIGHT 18
nCoV-2019_95_LEFT 4
nCoV-2019_95_RIGHT 1
nCoV-2019_96_LEFT 0
nCoV-2019_96_RIGHT 0
nCoV-2019_97_LEFT 7
nCoV-2019_97_RIGHT 24
nCoV-2019_98_LEFT 48
nCoV-2019_98_RIGHT 28
Trimmed primers from 23.08% (90165) of reads.
1.68% (6571) of reads were quality trimmed below the minimum length of 72 bp and were not written to file.
75.71% (295761) of reads started outside of primer regions. Since the -e flag was given, these reads were written to file.
0.15% (604) reads were ignored because they did not fall within an amplicon
13.43% (52453) of reads had their insert size smaller than their read length
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| amplicons | ` {"__current_case__": 1, "amplicon_info": {"values": [{"id": 3, "src": "hda"}]}, "filter_by": "yes"} ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| inc\_primers | ` true ` |
| min\_len | ` "1" ` |
| min\_qual | ` "0" ` |
| primer | ` {"__current_case__": 0, "input_bed": {"values": [{"id": 2, "src": "hda"}]}, "source": "history"} ` |
| primer\_pos\_wiggle | ` "0" ` |
| trimmed\_length | ` {"__current_case__": 1, "filter": "auto"} ` |
| window\_width | ` "4" ` |
</details>
- **Step 18: toolshed.g2.bx.psu.edu/repos/iuc/lofreq\_call/lofreq\_call/2.1.5+galaxy2**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
ln -s '/tmp/tmp1okvltvi/files/9/5/8/dataset_958a6cea-41ce-427c-b0a9-c563c2fa5359.dat' reference.fa && lofreq faidx reference.fa 2>&1 || echo "Error running samtools faidx for indexing fasta reference for lofreq" >&2 && ln -s '/tmp/tmp1okvltvi/files/5/d/4/dataset_5d4e442d-28fe-4c56-a0a6-22c37c727701.dat' reads.bam && ln -s -f '/tmp/tmp1okvltvi/files/_metadata_files/d/4/d/metadata_d4d3e38b-9b6b-4223-9203-811a59c01b1c.dat' reads.bam.bai && lofreq call-parallel --pp-threads ${GALAXY_SLOTS:-1} --verbose --ref 'reference.fa' --out variants.vcf --call-indels --min-cov 5 --max-depth 1000000 --min-bq 30 --min-alt-bq 30 --min-mq 20 --max-mq 255 --min-jq 0 --min-alt-jq 0 --def-alt-jq 0 --sig 0.0005 --bonf dynamic --no-default-filter reads.bam 2>&1 || (tool_exit_code=$? && cat "$TMPDIR/lofreq2_call_parallel*/*.log" 1>&2 && exit $tool_exit_code) && echo set_custom
```
**Exit Code:**
* ```console
0
```
**Standard Output:**
* ```console
INFO [2024-06-24 04:46:27,377]: Using 1 threads with following basic args: lofreq call --verbose --ref reference.fa --call-indels --min-cov 5 --max-depth 1000000 --min-bq 30 --min-alt-bq 30 --min-mq 20 --max-mq 255 --min-jq 0 --min-alt-jq 0 --def-alt-jq 0 --sig 0.0005 --bonf dynamic --no-default-filter reads.bam
INFO [2024-06-24 04:46:27,381]: Adding 3 commands to mp-pool
Number of substitution tests performed: 10089
Number of indel tests performed: 2318
INFO [2024-06-24 04:48:15,563]: Executing lofreq filter -i /tmp/tmp1okvltvi/tmp/lofreq2_call_parallel6gdg332b/concat.vcf.gz -o variants.vcf --no-defaults --snvqual-thresh 73 --indelqual-thresh 67
set_custom
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| call\_control | ` {"__current_case__": 1, "align_quals": {"alnqual": {"__current_case__": 0, "alnqual_choice": {"__current_case__": 1, "alnquals_to_use": "", "extended_baq": true}, "use_alnqual": ""}}, "bc_quals": {"alt_bq": {"__current_case__": 0, "modify": ""}, "min_alt_bq": "30", "min_bq": "30"}, "coverage": {"max_depth": "1000000", "min_cov": "5"}, "joint_qual": {"def_alt_jq": "0", "min_alt_jq": "0", "min_jq": "0"}, "map_quals": {"min_mq": "20", "use_mq": {"__current_case__": 0, "max_mq": "255", "no_mq": ""}}, "pe": {"use_orphan": false}, "set_call_options": "yes", "source_qual": {"use_src_qual": {"__current_case__": 0, "src_qual": ""}}} ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| filter\_control | ` {"__current_case__": 3, "bonf": "0", "filter_type": "set_custom", "others": false, "sig": "0.0005"} ` |
| reference\_source | ` {"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"} ` |
| regions | ` {"__current_case__": 0, "restrict_to_region": "genome"} ` |
| variant\_types | ` "--call-indels" ` |
</details>
- **Step 19: toolshed.g2.bx.psu.edu/repos/iuc/qualimap\_bamqc/qualimap\_bamqc/2.2.2d+galaxy3**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
export JAVA_OPTS="-Djava.awt.headless=true -Xmx${GALAXY_MEMORY_MB:-1024}m" && ln -s '/tmp/tmp1okvltvi/files/5/d/4/dataset_5d4e442d-28fe-4c56-a0a6-22c37c727701.dat' 'SRR11578257' && qualimap bamqc -bam 'SRR11578257' -outdir results -outformat html --collect-overlap-pairs -nw 400 --paint-chromosome-limits -hm 3 --skip-duplicated --skip-dup-mode 0 -nt ${GALAXY_SLOTS:-1} && sed 's|images_qualimapReport/||g;s|css/||g' results/qualimapReport.html > '/tmp/tmp1okvltvi/job_working_directory/000/16/outputs/dataset_383a1209-3554-4a47-9e7c-f9e32953b158.dat' && mkdir '/tmp/tmp1okvltvi/job_working_directory/000/16/outputs/dataset_383a1209-3554-4a47-9e7c-f9e32953b158_files' && mv results/css/*.css '/tmp/tmp1okvltvi/job_working_directory/000/16/outputs/dataset_383a1209-3554-4a47-9e7c-f9e32953b158_files' && mv results/css/*.png '/tmp/tmp1okvltvi/job_working_directory/000/16/outputs/dataset_383a1209-3554-4a47-9e7c-f9e32953b158_files' && if [ -d results/images_qualimapReport ]; then mv results/images_qualimapReport/* '/tmp/tmp1okvltvi/job_working_directory/000/16/outputs/dataset_383a1209-3554-4a47-9e7c-f9e32953b158_files' && for file in $(ls -A results/raw_data_qualimapReport); do mv "results/raw_data_qualimapReport/$file" `echo "results/$file" | sed 's/(//;s/)//'`; done fi && mv results/genome_results.txt results/summary_report.txt
```
**Exit Code:**
* ```console
0
```
**Standard Output:**
* ```console
Java memory size is set to 1200M
Launching application...
detected environment java options -Djava.awt.headless=true -Xmx1024m
QualiMap v.2.2.2-dev
Built on 2019-11-11 14:05
Selected tool: bamqc
Available memory (Mb): 262
Max memory (Mb): 1073
Starting bam qc....
Loading sam header...
Loading locator...
Loading reference...
Only flagged duplicate alignments will be skipped...
Number of windows: 400, effective number of windows: 399
Chunk of reads size: 1000
Number of threads: 1
Processed 50 out of 399 windows...
Processed 100 out of 399 windows...
Processed 150 out of 399 windows...
Processed 200 out of 399 windows...
Processed 250 out of 399 windows...
Processed 300 out of 399 windows...
Processed 350 out of 399 windows...
Total processed windows:399
Number of reads: 384049
Number of valid reads: 384054
Number of correct strand reads:0
Inside of regions...
Num mapped reads: 384049
Num mapped first of pair: 192026
Num mapped second of pair: 192023
Num singletons: 0
Time taken to analyze reads: 8
Computing descriptors...
numberOfMappedBases: 54865009
referenceSize: 29903
numberOfSequencedBases: 54854904
numberOfAs: 16761938
Computing per chromosome statistics...
Computing histograms...
Overall analysis time: 9
end of bam qc
Computing report...
Writing HTML report...
HTML report created successfully
Finished
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "bam" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| duplicate\_skipping | ` ["0"] ` |
| per\_base\_coverage | ` false ` |
| plot\_specific | ` {"genome_gc_distr": null, "homopolymer_size": "3", "n_bins": "400", "paint_chromosome_limits": true} ` |
| stats\_regions | ` {"__current_case__": 0, "region_select": "all"} ` |
</details>
- **Step 20: toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift\_filter/4.3+t.galaxy1**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
SnpSift -Xmx6G filter -f '/tmp/tmp1okvltvi/files/2/8/4/dataset_2844a6ea-6464-4b90-8118-6e425272e559.dat' -e '/tmp/tmp1okvltvi/job_working_directory/000/17/configs/tmpw4jjbwbk' > '/tmp/tmp1okvltvi/job_working_directory/000/17/outputs/dataset_c7a65083-7312-4724-bc84-d9b48dfbacef.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "vcf" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| filter\_expression | ` {"__current_case__": 0, "expr": "( ( DP4[2] + DP4[3] ) >= ( 0.1 * DP ) ) & ( ( DP4[2] + DP4[3] ) <= ( 1 * DP ) )", "type": "simple"} ` |
| filtering | ` {"__current_case__": 0, "mode": "entries"} ` |
| inverse | ` false ` |
</details>
- **Step 3: ARTIC primer BED**:
* step_state: scheduled
- **Step 21: toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift\_filter/4.3+t.galaxy1**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
SnpSift -Xmx6G filter -f '/tmp/tmp1okvltvi/files/2/8/4/dataset_2844a6ea-6464-4b90-8118-6e425272e559.dat' -e '/tmp/tmp1okvltvi/job_working_directory/000/18/configs/tmpt0ieircg' > '/tmp/tmp1okvltvi/job_working_directory/000/18/outputs/dataset_160ec68e-8138-4f21-a771-112d0e6e3855.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "vcf" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| filter\_expression | ` {"__current_case__": 0, "expr": "( DP > 1 ) & ( ( AF * DP ) >= ( 10 - 0.5 ) )", "type": "simple"} ` |
| filtering | ` {"__current_case__": 0, "mode": "entries"} ` |
| inverse | ` false ` |
</details>
- **Step 22: \_\_FILTER\_FAILED\_DATASETS\_\_**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| input | ` {"values": [{"id": 16, "src": "dce"}]} ` |
</details>
- **Step 23: toolshed.g2.bx.psu.edu/repos/iuc/ivar\_removereads/ivar\_removereads/1.4.3+galaxy0**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
cp '/tmp/tmp1okvltvi/files/6/9/5/dataset_69570f6e-eb26-4ff2-b682-b5da8b8ad3e9.dat' binding_sites.bed && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_removereads/5dc33613c288/ivar_removereads/sanitize_bed.py' binding_sites.bed && ln -s '/tmp/tmp1okvltvi/files/4/7/f/dataset_47fa7230-6519-4bdf-a3a7-ccee61760f5a.dat' amplicon_info.tsv && ivar getmasked -i '/tmp/tmp1okvltvi/files/c/7/a/dataset_c7a65083-7312-4724-bc84-d9b48dfbacef.dat' -b binding_sites.bed -f amplicon_info.tsv -p masked_primers && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/ivar_removereads/5dc33613c288/ivar_removereads/completemask.py' masked_primers.txt amplicon_info.tsv && ln -s '/tmp/tmp1okvltvi/files/5/d/4/dataset_5d4e442d-28fe-4c56-a0a6-22c37c727701.dat' sorted.bam && ln -s '/tmp/tmp1okvltvi/files/_metadata_files/d/4/d/metadata_d4d3e38b-9b6b-4223-9203-811a59c01b1c.dat' sorted.bam.bai && ivar removereads -i sorted.bam -b binding_sites.bed -p removed_reads.bam -t masked_primers.txt
```
**Exit Code:**
* ```console
0
```
**Standard Error:**
* ```console
Found 218 primers in BED file
Primer pair for nCoV-2019_7_RIGHT not found in BED file.
Primer pair for nCoV-2019_9_LEFT_alt4 not found in BED file.
Primer pair for nCoV-2019_9_RIGHT not found in BED file.
Primer pair for nCoV-2019_11_RIGHT not found in BED file.
Primer pair for nCoV-2019_14_RIGHT not found in BED file.
Primer pair for nCoV-2019_18_LEFT_alt2 not found in BED file.
Primer pair for nCoV-2019_18_RIGHT not found in BED file.
Primer pair for nCoV-2019_20_RIGHT not found in BED file.
Primer pair for nCoV-2019_21_RIGHT not found in BED file.
Primer pair for nCoV-2019_23_RIGHT not found in BED file.
Primer pair for nCoV-2019_44_RIGHT not found in BED file.
Primer pair for nCoV-2019_46_LEFT_alt1 not found in BED file.
Primer pair for nCoV-2019_46_RIGHT not found in BED file.
Primer pair for nCoV-2019_50_RIGHT not found in BED file.
Primer pair for nCoV-2019_76_RIGHT not found in BED file.
Primer pair for nCoV-2019_78_RIGHT not found in BED file.
Primer pair for nCoV-2019_89_RIGHT not found in BED file.
Primer pair for nCoV-2019_91_RIGHT not found in BED file.
Found 218 primers in BED file
```
**Standard Output:**
* ```console
nCoV-2019_6_LEFT
nCoV-2019_58_RIGHT
nCoV-2019_6_LEFT nCoV-2019_6_RIGHT nCoV-2019_58_RIGHT nCoV-2019_58_LEFT
Removing reads primed with any of:
nCoV-2019_58_LEFT nCoV-2019_58_RIGHT nCoV-2019_6_LEFT nCoV-2019_6_RIGHT
Writing to removed_reads.bam
Number of references: 1
Reference Name: NC_045512.2
Reference Length: 29903
Using Region: NC_045512.2
Sorted By Coordinate
Results:
60 reads were removed.
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| amplicons | ` {"__current_case__": 1, "amplicon_info": {"values": [{"id": 3, "src": "hda"}]}, "computed": "no"} ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
</details>
- **Step 24: \_\_FLATTEN\_\_**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| input | ` {"values": [{"id": 26, "src": "hdca"}]} ` |
| join\_identifier | ` "_" ` |
</details>
- **Step 25: toolshed.g2.bx.psu.edu/repos/iuc/lofreq\_call/lofreq\_call/2.1.5+galaxy2**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
ln -s '/tmp/tmp1okvltvi/files/9/5/8/dataset_958a6cea-41ce-427c-b0a9-c563c2fa5359.dat' reference.fa && lofreq faidx reference.fa 2>&1 || echo "Error running samtools faidx for indexing fasta reference for lofreq" >&2 && ln -s '/tmp/tmp1okvltvi/files/a/4/b/dataset_a4bdfada-6ff6-4594-961d-4c475e53d428.dat' reads.bam && ln -s -f '/tmp/tmp1okvltvi/files/_metadata_files/2/b/6/metadata_2b6f0bb0-c1f5-4e50-8d7b-a3169e29d970.dat' reads.bam.bai && lofreq call-parallel --pp-threads ${GALAXY_SLOTS:-1} --verbose --ref 'reference.fa' --out variants.vcf --call-indels --min-cov 5 --max-depth 1000000 --min-bq 30 --min-alt-bq 30 --min-mq 20 --max-mq 255 --min-jq 0 --min-alt-jq 0 --def-alt-jq 0 --sig 0.0005 --bonf dynamic --no-default-filter reads.bam 2>&1 || (tool_exit_code=$? && cat "$TMPDIR/lofreq2_call_parallel*/*.log" 1>&2 && exit $tool_exit_code) && echo set_custom
```
**Exit Code:**
* ```console
0
```
**Standard Output:**
* ```console
INFO [2024-06-24 04:48:55,392]: Using 1 threads with following basic args: lofreq call --verbose --ref reference.fa --call-indels --min-cov 5 --max-depth 1000000 --min-bq 30 --min-alt-bq 30 --min-mq 20 --max-mq 255 --min-jq 0 --min-alt-jq 0 --def-alt-jq 0 --sig 0.0005 --bonf dynamic --no-default-filter reads.bam
INFO [2024-06-24 04:48:55,396]: Adding 3 commands to mp-pool
Number of substitution tests performed: 10071
Number of indel tests performed: 2316
INFO [2024-06-24 04:50:28,224]: Executing lofreq filter -i /tmp/tmp1okvltvi/tmp/lofreq2_call_paralleloujw1r9r/concat.vcf.gz -o variants.vcf --no-defaults --snvqual-thresh 73 --indelqual-thresh 67
set_custom
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| call\_control | ` {"__current_case__": 1, "align_quals": {"alnqual": {"__current_case__": 0, "alnqual_choice": {"__current_case__": 1, "alnquals_to_use": "", "extended_baq": true}, "use_alnqual": ""}}, "bc_quals": {"alt_bq": {"__current_case__": 0, "modify": ""}, "min_alt_bq": "30", "min_bq": "30"}, "coverage": {"max_depth": "1000000", "min_cov": "5"}, "joint_qual": {"def_alt_jq": "0", "min_alt_jq": "0", "min_jq": "0"}, "map_quals": {"min_mq": "20", "use_mq": {"__current_case__": 0, "max_mq": "255", "no_mq": ""}}, "pe": {"use_orphan": false}, "set_call_options": "yes", "source_qual": {"use_src_qual": {"__current_case__": 0, "src_qual": ""}}} ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| filter\_control | ` {"__current_case__": 3, "bonf": "0", "filter_type": "set_custom", "others": false, "sig": "0.0005"} ` |
| reference\_source | ` {"__current_case__": 1, "ref": {"values": [{"id": 1, "src": "hda"}]}, "ref_selector": "history"} ` |
| regions | ` {"__current_case__": 0, "restrict_to_region": "genome"} ` |
| variant\_types | ` "--call-indels" ` |
</details>
- **Step 26: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
die() { echo "$@" 1>&2 ; exit 1; } && mkdir multiqc_WDir && mkdir multiqc_WDir/fastp_0 && ln -s '/tmp/tmp1okvltvi/files/5/d/1/dataset_5d1190a8-b41f-4f27-8650-7e0a8fd8dcda.dat' 'multiqc_WDir/fastp_0/SRR11578257fastp.json' && grep -q "report_title" 'multiqc_WDir/fastp_0/SRR11578257fastp.json' || die "'report_title' or 'report_title' not found in the file" && mkdir multiqc_WDir/samtools_1 && mkdir 'multiqc_WDir/samtools_1/stats_0' && grep -q 'This file was produced by samtools stats' /tmp/tmp1okvltvi/files/2/8/a/dataset_28a5c33b-8238-4767-bcab-30b50ffd6bae.dat || die "Module 'samtools: 'This file was produced by samtools stats' not found in the file 'SRR11578257'" && ln -s '/tmp/tmp1okvltvi/files/2/8/a/dataset_28a5c33b-8238-4767-bcab-30b50ffd6bae.dat' 'multiqc_WDir/samtools_1/stats_0/SRR11578257' && mkdir multiqc_WDir/qualimap_2 && sample="$(grep 'bam file = ' /tmp/tmp1okvltvi/files/2/5/8/dataset_25893355-7bb9-43b3-9459-40a5b55d4354.dat | sed 's/bam file = //g' | sed 's: ::g')" && dir_name="multiqc_WDir/qualimap_2/${sample}" && mkdir -p ${dir_name} && filepath_1="${dir_name}/genome_results.txt" && ln -sf '/tmp/tmp1okvltvi/files/2/5/8/dataset_25893355-7bb9-43b3-9459-40a5b55d4354.dat' ${filepath_1} && nested_dir_name="${dir_name}/raw_data_qualimapReport/" && mkdir -p ${nested_dir_name} && filepath_2="${nested_dir_name}/coverage_histogram.txt" && ln -sf '/tmp/tmp1okvltvi/files/5/1/c/dataset_51cbb163-f7e8-4701-99c5-996f6804f17d.dat' ${filepath_2} && nested_dir_name="${dir_name}/raw_data_qualimapReport/" && mkdir -p ${nested_dir_name} && filepath_3="${nested_dir_name}/mapped_reads_gc-content_distribution.txt" && ln -sf '/tmp/tmp1okvltvi/files/6/5/0/dataset_65039446-19b0-40f7-8ba5-fbe7f2ffb9e9.dat' ${filepath_3} && multiqc multiqc_WDir --filename 'report' --export
```
**Exit Code:**
* ```console
0
```
**Standard Error:**
* ```console
/// MultiQC 🔍 | v1.11
| multiqc | MultiQC Version v1.22.3 now available!
| multiqc | Search path : /tmp/tmp1okvltvi/job_working_directory/000/30/working/multiqc_WDir
| qualimap | Found 1 BamQC reports
| samtools | Found 1 stats reports
| fastp | Found 1 reports
| multiqc | Compressing plot data
| multiqc | Report : report.html
| multiqc | Data : report_data
| multiqc | Plots : report_plots
| multiqc | MultiQC complete
```
**Standard Output:**
* ```console
| searching | ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 100% 5/5
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| comment | ` "" ` |
| dbkey | ` "?" ` |
| export | ` true ` |
| flat | ` false ` |
| results | ` [{"__index__": 0, "software_cond": {"__current_case__": 7, "input": {"values": [{"id": 4, "src": "hdca"}]}, "software": "fastp"}}, {"__index__": 1, "software_cond": {"__current_case__": 24, "output": [{"__index__": 0, "type": {"__current_case__": 0, "input": {"values": [{"id": 8, "src": "hdca"}]}, "type": "stats"}}], "software": "samtools"}}, {"__index__": 2, "software_cond": {"__current_case__": 20, "input": {"values": [{"id": 27, "src": "hdca"}]}, "software": "qualimap"}}] ` |
| saveLog | ` false ` |
| title | ` "" ` |
</details>
- **Step 27: toolshed.g2.bx.psu.edu/repos/iuc/bcftools\_annotate/bcftools\_annotate/1.15.1+galaxy3**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
export BCFTOOLS_PLUGINS=`which bcftools | sed 's,bin/bcftools,libexec/bcftools,'`; bgzip -c '/tmp/tmp1okvltvi/files/2/8/4/dataset_2844a6ea-6464-4b90-8118-6e425272e559.dat' > input.vcf.gz && bcftools index input.vcf.gz && bgzip -c '/tmp/tmp1okvltvi/files/a/a/8/dataset_aa8a2b1d-4c10-4004-a7fb-6f41522b6a50.dat' > annotations.vcf.gz && bcftools index annotations.vcf.gz && bcftools annotate --columns 'QUAL,INFO' --annotations 'annotations.vcf.gz' --mark-sites '-AmpliconBias' --output-type 'v' --threads ${GALAXY_SLOTS:-4} input.vcf.gz > '/tmp/tmp1okvltvi/job_working_directory/000/21/outputs/dataset_f5440a59-a807-4c22-b64a-60ffcd273409.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| output\_type | ` "v" ` |
| sec\_annofile | ` {"annofile": {"__current_case__": 1, "anno_fmt": "vcf", "annotations": {"values": [{"id": 34, "src": "dce"}]}}, "columns": "QUAL,INFO", "mark_sites": "-AmpliconBias", "min_overlap": "", "set_id": ""} ` |
| sec\_annotate | ` {"remove": "", "rename_annots": null, "rename_chrs": null} ` |
| sec\_restrict | ` {"collapse": null, "exclude": "", "include": "", "invert_samples": false, "invert_samples_file": false, "regions": {"__current_case__": 0, "regions_src": "__none__"}, "regions_overlap": null, "samples": "", "samples_file": null} ` |
</details>
- **Step 28: toolshed.g2.bx.psu.edu/repos/iuc/snpsift/snpSift\_filter/4.3+t.galaxy1**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
SnpSift -Xmx6G filter -f '/tmp/tmp1okvltvi/files/a/a/8/dataset_aa8a2b1d-4c10-4004-a7fb-6f41522b6a50.dat' -e '/tmp/tmp1okvltvi/job_working_directory/000/22/configs/tmpqx6qwi61' > '/tmp/tmp1okvltvi/job_working_directory/000/22/outputs/dataset_f8572558-1be6-44c1-9476-6ffbd58d2cc1.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "vcf" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| filter\_expression | ` {"__current_case__": 0, "expr": "( DP > 1 ) & ( ( AF * DP ) >= ( 10 - 0.5 ) )", "type": "simple"} ` |
| filtering | ` {"__current_case__": 0, "mode": "entries"} ` |
| inverse | ` false ` |
</details>
- **Step 29: toolshed.g2.bx.psu.edu/repos/devteam/vcfvcfintersect/vcfvcfintersect/1.0.0\_rc3+galaxy0**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is error
**Command Line:**
* ```console
ln -s '/tmp/tmp1okvltvi/files/9/5/8/dataset_958a6cea-41ce-427c-b0a9-c563c2fa5359.dat' 'localref.fa' && vcfintersect -v -r 'localref.fa' -w "0" -i '/tmp/tmp1okvltvi/files/f/8/5/dataset_f8572558-1be6-44c1-9476-6ffbd58d2cc1.dat' '/tmp/tmp1okvltvi/files/1/6/0/dataset_160ec68e-8138-4f21-a771-112d0e6e3855.dat' > '/tmp/tmp1okvltvi/job_working_directory/000/23/outputs/dataset_c100d280-03cd-44b9-9c26-3aaf4a0e45a7.dat'
```
**Exit Code:**
* ```console
125
```
**Standard Error:**
* ```console
Unable to find image 'quay.io/biocontainers/vcflib:1.0.0_rc3--py37hc088bd4_0' locally
1.0.0_rc3--py37hc088bd4_0: Pulling from biocontainers/vcflib
docker: [DEPRECATION NOTICE] Docker Image Format v1 and Docker Image manifest version 2, schema 1 support is disabled by default and will be removed in an upcoming release. Suggest the author of quay.io/biocontainers/vcflib:1.0.0_rc3--py37hc088bd4_0 to upgrade the image to the OCI Format or Docker Image manifest v2, schema 2. More information at https://docs.docker.com/go/deprecated-image-specs/.
See 'docker run --help'.
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "vcf" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| adv\_options | ` {"__current_case__": 0, "adv_options_selector": "no"} ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| invert | ` true ` |
| isect\_union | ` "-i" ` |
| loci | ` false ` |
| reference\_source | ` {"__current_case__": 1, "ref_file": {"values": [{"id": 1, "src": "hda"}]}, "reference_source_selector": "history"} ` |
| window\_size | ` "0" ` |
</details>
- **Step 30: toolshed.g2.bx.psu.edu/repos/iuc/bcftools\_annotate/bcftools\_annotate/1.15.1+galaxy3**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is paused
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| output\_type | ` "v" ` |
| sec\_annofile | ` {"annofile": {"__current_case__": 1, "anno_fmt": "vcf", "annotations": {"values": [{"id": 37, "src": "dce"}]}}, "columns": "QUAL,INFO", "mark_sites": "+AmpliconBias", "min_overlap": "", "set_id": ""} ` |
| sec\_annotate | ` {"remove": "", "rename_annots": null, "rename_chrs": null} ` |
| sec\_restrict | ` {"collapse": null, "exclude": "", "include": "", "invert_samples": false, "invert_samples_file": false, "regions": {"__current_case__": 0, "regions_src": "__none__"}, "regions_overlap": null, "samples": "", "samples_file": null} ` |
</details>
- **Step 4: ARTIC primers to amplicon assignments**:
* step_state: scheduled
- **Step 31: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_replace\_in\_line/9.3+galaxy1**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is paused
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| replacements | ` [{"__index__": 0, "find_pattern": "^##INFO=<ID=AmpliconBias,.+$", "replace_pattern": "##INFO=<ID=AmpliconBias,Number=0,Type=Flag,Description=\"Indicates that the AF value of the variant could not be corrected for potential amplicon bias.\">"}, {"__index__": 1, "find_pattern": "^##INFO=<ID=AF,.+$", "replace_pattern": "##INFO=<ID=AF,Number=1,Type=Float,Description=\"Lofreq Allele Frequency; Fraction of variant-supporting bases with q > --min-bq among all bases at the site\">"}] ` |
</details>
- **Step 32: SnpEff eff covid19 version**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is new
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "vcf" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| annotations | ` ["-formatEff", "-classic"] ` |
| chr | ` "" ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| csvStats | ` false ` |
| dbkey | ` "?" ` |
| filter | ` {"__current_case__": 0, "specificEffects": "no"} ` |
| filterOut | ` ["-no-downstream", "-no-intergenic", "-no-upstream"] ` |
| generate\_stats | ` true ` |
| genome\_version | ` "NC_045512.2" ` |
| inputFormat | ` "vcf" ` |
| intervals | ` None ` |
| noLog | ` true ` |
| offset | ` "default" ` |
| outputConditional | ` {"__current_case__": 0, "outputFormat": "vcf"} ` |
| transcripts | ` None ` |
| udLength | ` "0" ` |
</details>
- **Step 33: toolshed.g2.bx.psu.edu/repos/iuc/lofreq\_filter/lofreq\_filter/2.1.5+galaxy0**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is new
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| af | ` {"af_max": "0.0", "af_min": "0.0"} ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| coverage | ` {"cov_max": "0", "cov_min": "0"} ` |
| dbkey | ` "?" ` |
| filter\_by\_type | ` {"__current_case__": 0, "keep_only": "", "qual": {"indelqual_filter": {"__current_case__": 0, "indelqual": "no"}, "snvqual_filter": {"__current_case__": 0, "snvqual": "no"}}} ` |
| flag\_or\_drop | ` "--print-all" ` |
| sb | ` {"sb_filter": {"__current_case__": 2, "sb_alpha": "0.001", "sb_compound": true, "sb_indels": false, "sb_mtc": "fdr", "strand_bias": "mtc"}} ` |
</details>
- **Step 5: Read removal minimum AF**:
* step_state: scheduled
- **Step 6: Read removal maximum AF**:
* step_state: scheduled
- **Step 7: Minimum DP required after amplicon bias correction**:
* step_state: scheduled
- **Step 8: Minimum DP_ALT required after amplicon bias correction**:
* step_state: scheduled
- **Step 9: toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/0.23.4+galaxy0**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
ln -sf '/tmp/tmp1okvltvi/files/8/6/4/dataset_86457b47-8aaa-4190-9ae7-9f7fe3b09db3.dat' 'SRR11578257.fastq.gz' && ln -sf '/tmp/tmp1okvltvi/files/4/5/e/dataset_45e19ace-7030-48d9-a8c9-4e60e6e3c95d.dat' 'SRR11578257_R2.fastq.gz' && fastp --thread ${GALAXY_SLOTS:-1} --report_title 'fastp report for SRR11578257.fastq.gz' -i 'SRR11578257.fastq.gz' -o first.fastq.gz -I 'SRR11578257_R2.fastq.gz' -O second.fastq.gz --detect_adapter_for_pe && mv first.fastq.gz '/tmp/tmp1okvltvi/job_working_directory/000/6/outputs/dataset_5f0f0c49-fea0-4cc5-98ab-00106f0ec2a2.dat' && mv second.fastq.gz '/tmp/tmp1okvltvi/job_working_directory/000/6/outputs/dataset_b428099c-035d-4931-a09e-6062a17d8a72.dat'
```
**Exit Code:**
* ```console
0
```
**Standard Error:**
* ```console
Detecting adapter sequence for read1...
ACCTTAGAATCAAGATTGTTAGAATTCCAAGCTATAACGCAGCCTGTAAAATCATCTGGT
Detecting adapter sequence for read2...
No adapter detected for read2
Read1 before filtering:
total reads: 201367
total bases: 29302687
Q20 bases: 28139796(96.0315%)
Q30 bases: 27281893(93.1037%)
Read2 before filtering:
total reads: 201367
total bases: 29398146
Q20 bases: 27778430(94.4904%)
Q30 bases: 26748339(90.9865%)
Read1 after filtering:
total reads: 195579
total bases: 28439132
Q20 bases: 27427010(96.4411%)
Q30 bases: 26623439(93.6155%)
Read2 after filtering:
total reads: 195579
total bases: 28450670
Q20 bases: 27054927(95.0942%)
Q30 bases: 26092568(91.7116%)
Filtering result:
reads passed filter: 391158
reads failed due to low quality: 5634
reads failed due to too many N: 1164
reads failed due to too short: 4778
reads with adapter trimmed: 18954
bases trimmed due to adapters: 261387
Duplication rate: 20.2521%
Insert size peak (evaluated by paired-end reads): 230
JSON report: fastp.json
HTML report: fastp.html
fastp --thread 1 --report_title fastp report for SRR11578257.fastq.gz -i SRR11578257.fastq.gz -o first.fastq.gz -I SRR11578257_R2.fastq.gz -O second.fastq.gz --detect_adapter_for_pe
fastp v0.23.4, time used: 12 seconds
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| filter\_options | ` {"length_filtering_options": {"disable_length_filtering": false, "length_limit": null, "length_required": null}, "low_complexity_filter": {"complexity_threshold": null, "enable_low_complexity_filter": false}, "quality_filtering_options": {"disable_quality_filtering": false, "n_base_limit": null, "qualified_quality_phred": null, "unqualified_percent_limit": null}} ` |
| output\_options | ` {"report_html": true, "report_json": true} ` |
| overrepresented\_sequence\_analysis | ` {"overrepresentation_analysis": false, "overrepresentation_sampling": null} ` |
| read\_mod\_options | ` {"base_correction_options": {"correction": false}, "cutting_by_quality_options": {"cut_by_quality3": false, "cut_by_quality5": false, "cut_mean_quality": null, "cut_window_size": null}, "polyg_tail_trimming": {"__current_case__": 1, "poly_g_min_len": null, "trimming_select": ""}, "polyx_tail_trimming": {"__current_case__": 1, "polyx_trimming_select": ""}, "umi_processing": {"umi": false, "umi_len": null, "umi_loc": "", "umi_prefix": ""}} ` |
| single\_paired | ` {"__current_case__": 2, "adapter_trimming_options": {"adapter_sequence1": "", "adapter_sequence2": "", "disable_adapter_trimming": false}, "global_trimming_options": {"trim_front1": null, "trim_front2": null, "trim_tail1": null, "trim_tail2": null}, "paired_input": {"values": [{"id": 1, "src": "dce"}]}, "single_paired_selector": "paired_collection"} ` |
</details>
- **Step 10: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
cd ../; python _evaluate_expression_.py
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "748d824c31e411efa2a73db16abbad8e" ` |
| chromInfo | ` "/tmp/tmp1okvltvi/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "( ( DP4[2] + DP4[3] ) >= ( ", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 2, "component_value": "0.1", "select_param_type": "float"}}, {"__index__": 2, "param_type": {"__current_case__": 0, "component_value": " * DP ) ) & ( ( DP4[2] + DP4[3] ) <= ( ", "select_param_type": "text"}}, {"__index__": 3, "param_type": {"__current_case__": 2, "component_value": "1.0", "select_param_type": "float"}}, {"__index__": 4, "param_type": {"__current_case__": 0, "component_value": " * DP ) )", "select_param_type": "text"}}] ` |
| dbkey | ` "?" ` |
</details>
</details>-
Other invocation details
- **error_message** * Failed to run workflow, at least one job is in [error] state. - **history_id** * 97ab1d6a8bc6a7c3 - **history_state** * error - **invocation_id** * 97ab1d6a8bc6a7c3 - **invocation_state** * scheduled - **workflow_id** * 97ab1d6a8bc6a7c3
Hello! This is an automated update of the following workflow: workflows/sars-cov-2-variant-calling/sars-cov-2-pe-illumina-artic-variant-calling. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.
By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:
toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.2.2d+galaxy3should be updated totoolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.2.2c+galaxy1toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy0should be updated totoolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_replace_in_line/9.3+galaxy1The workflow release number has been updated from 0.5.2 to 0.5.3.