github-actions[bot]
commented
6 months ago Test Results (powered by Planemo)
Test Summary
| Test State | Count |
|---|---|
| Total | 1 |
| Passed | 0 |
| Error | 0 |
| Failure | 1 |
| Skipped | 0 |
Failed Tests
*❌ chipseq-sr.ga_0
**Problems**:
* ```
Output with path /tmp/tmptemsvguy/cutadapt__c7d01702-9fdc-461c-882f-493ab998ac47 different than expected
Expected text '4.7 50000 587 749 49251' in output ('Sample cutadapt_version r_processed r_with_adapters r_too_short r_written bp_processed quality_trimmed bp_written percent_trimmed
wt_H3K4me3 4.8 50000 587 749 49251 2550000 111042 2432375 4.612745098039215
')
```
#### Workflow invocation details
* Invocation Messages
*
Steps
- **Step 1: SR fastq input**: * step_state: scheduled - **Step 2: adapter_forward**: * step_state: scheduled - **Step 11: Bigwig from MACS2**: * step_state: scheduled *Jobs
- **Job 1:** * Job state is ok **Command Line:** * ```console grep -v "^track" '/tmp/tmpkbcfkqlu/files/d/d/9/dataset_dd937e57-6f67-44eb-9b3a-6e9b6e651861.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len' '/tmp/tmpkbcfkqlu/job_working_directory/000/7/outputs/dataset_cc677897-7cfa-4729-af4e-c090ae82e63c.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2 ``` **Exit Code:** * ```console 0 ``` **Traceback:** * ```console ``` **Job Parameters:** * | Job parameter | Parameter value | | ------------- | --------------- | | \_\_input\_ext | ` "bedgraph" ` | | \_\_workflow\_invocation\_uuid\_\_ | ` "535cd6a2006311efbc8c59896ce58183" ` | | chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len" ` | | dbkey | ` "mm10" ` | | settings | ` {"__current_case__": 0, "settingsType": "preset"} ` | - **Step 12: MultiQC**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
die() { echo "$@" 1>&2 ; exit 1; } && mkdir multiqc_WDir && mkdir multiqc_WDir/cutadapt_0 && ln -s '/tmp/tmpkbcfkqlu/files/e/2/7/dataset_e27c14b5-2e06-4934-985e-4e969b8be08b.dat' 'multiqc_WDir/cutadapt_0/wt_H3K4me3.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/wt_H3K4me3.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/wt_H3K4me3.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" && mkdir multiqc_WDir/bowtie2_1 && grep -q '% overall alignment rate' /tmp/tmpkbcfkqlu/files/9/4/b/dataset_94b48776-43a0-42bd-8c75-17c369898ac2.dat || die "Module 'bowtie2: '% overall alignment rate' not found in the file 'wt_H3K4me3'" && ln -s '/tmp/tmpkbcfkqlu/files/9/4/b/dataset_94b48776-43a0-42bd-8c75-17c369898ac2.dat' 'multiqc_WDir/bowtie2_1/wt_H3K4me3' && mkdir multiqc_WDir/macs2_2 && grep -q "# This file is generated by MACS" /tmp/tmpkbcfkqlu/files/4/a/f/dataset_4af43192-b47f-4729-aa70-2b0c2cd2dcde.dat || die "'# This file is generated by MACS' not found in the file" && ln -s '/tmp/tmpkbcfkqlu/files/4/a/f/dataset_4af43192-b47f-4729-aa70-2b0c2cd2dcde.dat' 'multiqc_WDir/macs2_2/wt_H3K4me3_peaks.xls' && multiqc multiqc_WDir --filename 'report' --export
```
**Exit Code:**
* ```console
0
```
**Standard Error:**
* ```console
/// MultiQC 🔍 | v1.11
| multiqc | MultiQC Version v1.21 now available!
| multiqc | Search path : /tmp/tmpkbcfkqlu/job_working_directory/000/8/working/multiqc_WDir
| macs2 | Found 1 logs
| bowtie2 | Found 1 reports
| cutadapt | Found 1 reports
| multiqc | Compressing plot data
| multiqc | Report : report.html
| multiqc | Data : report_data
| multiqc | Plots : report_plots
| multiqc | MultiQC complete
```
**Standard Output:**
* ```console
| searching | ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 100% 4/4
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "535cd6a2006311efbc8c59896ce58183" ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len" ` |
| comment | ` "" ` |
| dbkey | ` "mm10" ` |
| export | ` true ` |
| flat | ` false ` |
| results | ` [{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}, {"__index__": 1, "software_cond": {"__current_case__": 3, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 16, "input": {"values": [{"id": 7, "src": "hdca"}]}, "software": "macs2"}}] ` |
| saveLog | ` false ` |
| title | ` "" ` |
</details>
- **Step 3: reference_genome**:
* step_state: scheduled
- **Step 4: effective_genome_size**:
* step_state: scheduled
- **Step 5: normalize_profile**:
* step_state: scheduled
- **Step 6: Cutadapt (remove adapter + bad quality bases)**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
ln -f -s '/tmp/tmpkbcfkqlu/files/6/a/f/dataset_6af49390-2004-4eb4-834c-617cc0e07956.dat' 'wt_H3K4me3.fq' && cutadapt -j=${GALAXY_SLOTS:-4} -a 'Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'='GATCGGAAGAGCACACGTCTGAACTCCAGTCAC' --output='out1.fq' --error-rate=0.1 --times=1 --overlap=3 --action=trim --minimum-length=15 --quality-cutoff=30 'wt_H3K4me3.fq' > report.txt
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_job\_resource | ` {"__current_case__": 0, "__job_resource__select": "no"} ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "535cd6a2006311efbc8c59896ce58183" ` |
| adapter\_options | ` {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"} ` |
| chromInfo | ` "/tmp/tmpkbcfkqlu/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| filter\_options | ` {"discard_cassava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "minimum_length": "15", "pair_filter": "any"} ` |
| library | ` {"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "GATCGGAAGAGCACACGTCTGAACTCCAGTCAC", "adapter_name": "Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters": [], "front_adapters": []}, "type": "single"} ` |
| output\_selector | ` ["report"] ` |
| read\_mod\_options | ` {"cut": "0", "length_tag": "", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "30", "rename": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "strip_suffix": "", "trim_n": false, "zero_cap": false} ` |
</details>
- **Step 7: Bowtie2 map on reference**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
set -o | grep -q pipefail && set -o pipefail; ln -f -s '/tmp/tmpkbcfkqlu/files/d/e/1/dataset_de181ee8-a22c-460b-aab7-ee7eaa5bbbbb.dat' input_f.fastq && bowtie2 -p ${GALAXY_SLOTS:-4} -x '/cvmfs/data.galaxyproject.org/byhand/mm10/bowtie2_index/mm10' -U 'input_f.fastq' 2> '/tmp/tmpkbcfkqlu/job_working_directory/000/3/outputs/dataset_94b48776-43a0-42bd-8c75-17c369898ac2.dat' | samtools sort --no-PG -@${GALAXY_SLOTS:-2} -T "${TMPDIR:-.}" -O bam -o '/tmp/tmpkbcfkqlu/job_working_directory/000/3/outputs/dataset_c534ea8c-2a74-4c44-8428-1d708c4e6b4e.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_job\_resource | ` {"__current_case__": 0, "__job_resource__select": "no"} ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "535cd6a2006311efbc8c59896ce58183" ` |
| analysis\_type | ` {"__current_case__": 0, "analysis_type_selector": "simple", "presets": "no_presets"} ` |
| chromInfo | ` "/tmp/tmpkbcfkqlu/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| library | ` {"__current_case__": 0, "aligned_file": false, "input_1": {"values": [{"id": 2, "src": "dce"}]}, "type": "single", "unaligned_file": false} ` |
| reference\_genome | ` {"__current_case__": 0, "index": "mm10", "source": "indexed"} ` |
| rg | ` {"__current_case__": 3, "rg_selector": "do_not_set"} ` |
| sam\_options | ` {"__current_case__": 1, "sam_options_selector": "no"} ` |
| save\_mapping\_stats | ` true ` |
</details>
- **Step 8: filter MAPQ30**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
ln -s '/tmp/tmpkbcfkqlu/files/c/5/3/dataset_c534ea8c-2a74-4c44-8428-1d708c4e6b4e.dat' input.bam && ln -s '/tmp/tmpkbcfkqlu/files/_metadata_files/b/c/a/metadata_bca9784a-ffef-4d93-be5a-e95173978173.dat' input.bai && samtools view -o '/tmp/tmpkbcfkqlu/job_working_directory/000/4/outputs/dataset_5840375a-bb2f-464b-9e6a-3ba8c0c2c147.dat' -h -b -q 30 input.bam
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "bam" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "535cd6a2006311efbc8c59896ce58183" ` |
| bed\_file | ` None ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len" ` |
| dbkey | ` "mm10" ` |
| flag | ` {"__current_case__": 0, "filter": "no"} ` |
| header | ` "-h" ` |
| library | ` "" ` |
| mapq | ` "30" ` |
| outputtype | ` "bam" ` |
| possibly\_select\_inverse | ` false ` |
| read\_group | ` "" ` |
| regions | ` "" ` |
</details>
- **Step 9: Call Peaks with MACS2**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
export PYTHON_EGG_CACHE=`pwd` && (macs2 callpeak -t '/tmp/tmpkbcfkqlu/files/5/8/4/dataset_5840375a-bb2f-464b-9e6a-3ba8c0c2c147.dat' --name wt_H3K4me3 --format BAM --gsize '1870000000' --SPMR --call-summits --keep-dup '1' --d-min 20 --buffer-size 100000 --bdg --qvalue '0.05' --nomodel --extsize '200' --shift '0' 2>&1 > macs2_stderr) && cp wt_H3K4me3_peaks.xls '/tmp/tmpkbcfkqlu/job_working_directory/000/5/outputs/dataset_4af43192-b47f-4729-aa70-2b0c2cd2dcde.dat' && ( count=`ls -1 wt_H3K4me3* 2>/dev/null | wc -l`; if [ $count != 0 ]; then mkdir '/tmp/tmpkbcfkqlu/job_working_directory/000/5/outputs/dataset_1fa86150-0a39-4099-a611-f331f800b391_files' && cp -r wt_H3K4me3* '/tmp/tmpkbcfkqlu/job_working_directory/000/5/outputs/dataset_1fa86150-0a39-4099-a611-f331f800b391_files' && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/macs2/86e2413cf3f8/macs2/dir2html.py' '/tmp/tmpkbcfkqlu/job_working_directory/000/5/outputs/dataset_1fa86150-0a39-4099-a611-f331f800b391_files' macs2_stderr > '/tmp/tmpkbcfkqlu/job_working_directory/000/5/outputs/dataset_1fa86150-0a39-4099-a611-f331f800b391.dat'; fi; ) && exit_code_for_galaxy=$? && cat macs2_stderr 2>&1 && (exit $exit_code_for_galaxy)
```
**Exit Code:**
* ```console
0
```
**Standard Output:**
* ```console
INFO @ Mon, 22 Apr 2024 04:49:13:
# Command line: callpeak -t /tmp/tmpkbcfkqlu/files/5/8/4/dataset_5840375a-bb2f-464b-9e6a-3ba8c0c2c147.dat --name wt_H3K4me3 --format BAM --gsize 1870000000 --SPMR --call-summits --keep-dup 1 --d-min 20 --buffer-size 100000 --bdg --qvalue 0.05 --nomodel --extsize 200 --shift 0
# ARGUMENTS LIST:
# name = wt_H3K4me3
# format = BAM
# ChIP-seq file = ['/tmp/tmpkbcfkqlu/files/5/8/4/dataset_5840375a-bb2f-464b-9e6a-3ba8c0c2c147.dat']
# control file = None
# effective genome size = 1.87e+09
# band width = 300
# model fold = [5, 50]
# qvalue cutoff = 5.00e-02
# The maximum gap between significant sites is assigned as the read length/tag size.
# The minimum length of peaks is assigned as the predicted fragment length "d".
# Larger dataset will be scaled towards smaller dataset.
# Range for calculating regional lambda is: 10000 bps
# Broad region calling is off
# Paired-End mode is off
# Searching for subpeak summits is on
# MACS will save fragment pileup signal per million reads
INFO @ Mon, 22 Apr 2024 04:49:13: #1 read tag files...
INFO @ Mon, 22 Apr 2024 04:49:13: #1 read treatment tags...
INFO @ Mon, 22 Apr 2024 04:49:13: 44078 reads have been read.
INFO @ Mon, 22 Apr 2024 04:49:13: #1 tag size is determined as 49 bps
INFO @ Mon, 22 Apr 2024 04:49:13: #1 tag size = 49.0
INFO @ Mon, 22 Apr 2024 04:49:13: #1 total tags in treatment: 44078
INFO @ Mon, 22 Apr 2024 04:49:13: #1 user defined the maximum tags...
INFO @ Mon, 22 Apr 2024 04:49:13: #1 filter out redundant tags at the same location and the same strand by allowing at most 1 tag(s)
INFO @ Mon, 22 Apr 2024 04:49:13: #1 tags after filtering in treatment: 44038
INFO @ Mon, 22 Apr 2024 04:49:13: #1 Redundant rate of treatment: 0.00
INFO @ Mon, 22 Apr 2024 04:49:13: #1 finished!
INFO @ Mon, 22 Apr 2024 04:49:13: #2 Build Peak Model...
INFO @ Mon, 22 Apr 2024 04:49:13: #2 Skipped...
INFO @ Mon, 22 Apr 2024 04:49:13: #2 Use 200 as fragment length
INFO @ Mon, 22 Apr 2024 04:49:13: #3 Call peaks...
INFO @ Mon, 22 Apr 2024 04:49:13: #3 Going to call summits inside each peak ...
INFO @ Mon, 22 Apr 2024 04:49:13: #3 Pre-compute pvalue-qvalue table...
INFO @ Mon, 22 Apr 2024 04:49:13: #3 In the peak calling step, the following will be performed simultaneously:
INFO @ Mon, 22 Apr 2024 04:49:13: #3 Write bedGraph files for treatment pileup (after scaling if necessary)... wt_H3K4me3_treat_pileup.bdg
INFO @ Mon, 22 Apr 2024 04:49:13: #3 Write bedGraph files for control lambda (after scaling if necessary)... wt_H3K4me3_control_lambda.bdg
INFO @ Mon, 22 Apr 2024 04:49:13: #3 --SPMR is requested, so pileup will be normalized by sequencing depth in million reads.
INFO @ Mon, 22 Apr 2024 04:49:13: #3 Call peaks for each chromosome...
INFO @ Mon, 22 Apr 2024 04:49:13: #4 Write output xls file... wt_H3K4me3_peaks.xls
INFO @ Mon, 22 Apr 2024 04:49:13: #4 Write peak in narrowPeak format file... wt_H3K4me3_peaks.narrowPeak
INFO @ Mon, 22 Apr 2024 04:49:13: #4 Write summits bed file... wt_H3K4me3_summits.bed
INFO @ Mon, 22 Apr 2024 04:49:13: Done!
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "535cd6a2006311efbc8c59896ce58183" ` |
| advanced\_options | ` {"broad_options": {"__current_case__": 1, "broad_options_selector": "nobroad", "call_summits": true}, "buffer_size": "100000", "d_min": "20", "keep_dup_options": {"__current_case__": 1, "keep_dup_options_selector": "1"}, "llocal": null, "nolambda": false, "ratio": null, "slocal": null, "spmr": true, "to_large": false} ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len" ` |
| control | ` {"__current_case__": 1, "c_select": "No"} ` |
| cutoff\_options | ` {"__current_case__": 1, "cutoff_options_selector": "qvalue", "qvalue": "0.05"} ` |
| dbkey | ` "mm10" ` |
| effective\_genome\_size\_options | ` {"__current_case__": 4, "effective_genome_size_options_selector": "user_defined", "gsize": "1870000000"} ` |
| format | ` "BAM" ` |
| nomodel\_type | ` {"__current_case__": 1, "extsize": "200", "nomodel_type_selector": "nomodel", "shift": "0"} ` |
| outputs | ` ["peaks_tabular", "summits", "bdg", "html"] ` |
| treatment | ` {"__current_case__": 0, "input_treatment_file": {"values": [{"id": 6, "src": "dce"}]}, "t_multi_select": "No"} ` |
</details>
- **Step 10: summary of MACS2**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
grep -P -A 0 -B 0 --no-group-separator -i -- '^#' '/tmp/tmpkbcfkqlu/files/4/a/f/dataset_4af43192-b47f-4729-aa70-2b0c2cd2dcde.dat' > '/tmp/tmpkbcfkqlu/job_working_directory/000/6/outputs/dataset_643c0d6f-ab78-498e-be77-4d8dcd6c8f87.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "535cd6a2006311efbc8c59896ce58183" ` |
| case\_sensitive | ` "-i" ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len" ` |
| color | ` "NOCOLOR" ` |
| dbkey | ` "mm10" ` |
| invert | ` "" ` |
| lines\_after | ` "0" ` |
| lines\_before | ` "0" ` |
| regex\_type | ` "-P" ` |
| url\_paste | ` "^#" ` |
</details>
</details>-
Other invocation details
- **history_id** * 4cd1abfe055287b5 - **history_state** * ok - **invocation_id** * 4cd1abfe055287b5 - **invocation_state** * scheduled - **workflow_id** * 4cd1abfe055287b5
Hello! This is an automated update of the following workflow: workflows/epigenetics/chipseq-sr. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.
By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:
toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.7+galaxy0should be updated totoolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy0The workflow release number has been updated from 0.8 to 0.9.