github-actions[bot]
commented
2 months ago Test Results (powered by Planemo)
Test Summary
| Test State | Count |
|---|---|
| Total | 1 |
| Passed | 0 |
| Error | 0 |
| Failure | 1 |
| Skipped | 0 |
Failed Tests
*❌ atacseq.ga_0
**Problems**:
* ```
Output with path /tmp/tmpbgdq5mbe/cutadapt__9c54bba4-4c81-4608-95fd-ae3ea10cd5ab different than expected
Expected line 'SRR891268_chr22_enriched_2 4.8 285247 41011 40415 4283 280964 28524700 480633 27163516 4.771948521807416' in output ('Sample cutadapt_version pairs_processed r1_with_adapters r2_with_adapters pairs_too_short pairs_written bp_processed quality_trimmed bp_written percent_trimmed
SRR891268_chr22_enriched_2 4.9 285247 41011 40415 4283 280964 28524700 480633 27163516 4.771948521807416
')
```
#### Workflow invocation details
* Invocation Messages
*
Steps
- **Step 1: PE fastq input**: * step_state: scheduled - **Step 2: reference_genome**: * step_state: scheduled - **Step 11: convert BAM to BED to improve peak calling**: * step_state: scheduled *Jobs
- **Job 1:** * Job state is ok **Command Line:** * ```console ln -s '/tmp/tmpamie7oua/files/e/0/b/dataset_e0b07879-5fe1-4901-91c0-b3630bf3c6f1.dat' ./input.bam && bedtools bamtobed -i ./input.bam > '/tmp/tmpamie7oua/job_working_directory/000/9/outputs/dataset_7fcf7cc5-4b55-4677-a34e-4ec2913376a5.dat' ``` **Exit Code:** * ```console 0 ``` **Traceback:** * ```console ``` **Job Parameters:** * | Job parameter | Parameter value | | ------------- | --------------- | | \_\_input\_ext | ` "input" ` | | \_\_job\_resource | ` {"__current_case__": 0, "__job_resource__select": "no"} ` | | \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` | | chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` | | dbkey | ` "hg19" ` | | ed\_score | ` false ` | | option | ` "" ` | | split | ` false ` | | tag | ` "" ` | - **Step 12: Compute fragment length histogram**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
ln -s '/tmp/tmpamie7oua/files/e/0/b/dataset_e0b07879-5fe1-4901-91c0-b3630bf3c6f1.dat' localbam.bam && ln -f -s '/tmp/tmpamie7oua/files/_metadata_files/d/e/c/metadata_decf5dc4-3655-4d48-a0f4-e5dcfae314a5.dat' localbam.bam.bai && java -jar '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/pe_histogram/bd1416eea1f0/pe_histogram/PEHistogram.jar' -B localbam.bam -I localbam.bam.bai -u 500 -p '/tmp/tmpamie7oua/job_working_directory/000/10/outputs/dataset_99509cb4-0e6c-4094-9611-a65f3bd01bd8.dat' -t '/tmp/tmpamie7oua/job_working_directory/000/10/outputs/dataset_d932cd06-612d-487d-92db-be3073a6fc82.dat' 1>/dev/null
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "bam" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| dbkey | ` "hg19" ` |
| lower\_limit | ` None ` |
| upper\_limit | ` "500" ` |
</details>
- **Step 13: number of reads**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) && addmemory=${GALAXY_MEMORY_MB_PER_SLOT:-768} && ((addmemory=addmemory*75/100)) && ln -s '/tmp/tmpamie7oua/files/e/0/b/dataset_e0b07879-5fe1-4901-91c0-b3630bf3c6f1.dat' infile && ln -s '/tmp/tmpamie7oua/files/_metadata_files/d/e/c/metadata_decf5dc4-3655-4d48-a0f4-e5dcfae314a5.dat' infile.bai && samtools view -@ $addthreads -c -o outfile infile
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| addref\_cond | ` {"__current_case__": 0, "addref_select": "no"} ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| dbkey | ` "hg19" ` |
| mode | ` {"__current_case__": 0, "output_options": {"__current_case__": 1, "reads_report_type": "count"}, "outtype": "all_reads"} ` |
</details>
- **Step 14: Call Peak with MACS2**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
export PYTHON_EGG_CACHE=`pwd` && (macs2 callpeak -t '/tmp/tmpamie7oua/files/7/f/c/dataset_7fcf7cc5-4b55-4677-a34e-4ec2913376a5.dat' --name SRR891268_chr22_enriched --format BED --gsize '2700000000' --call-summits --keep-dup 'all' --d-min 20 --buffer-size 100000 --bdg --qvalue '0.05' --nomodel --extsize '200' --shift '-100' 2>&1 > macs2_stderr) && cp SRR891268_chr22_enriched_peaks.xls '/tmp/tmpamie7oua/job_working_directory/000/12/outputs/dataset_58c08a79-21f4-4508-a02e-0995e093676b.dat' && ( count=`ls -1 SRR891268_chr22_enriched* 2>/dev/null | wc -l`; if [ $count != 0 ]; then mkdir '/tmp/tmpamie7oua/job_working_directory/000/12/outputs/dataset_a071a297-cc44-43fc-b359-5ec505395edb_files' && cp -r SRR891268_chr22_enriched* '/tmp/tmpamie7oua/job_working_directory/000/12/outputs/dataset_a071a297-cc44-43fc-b359-5ec505395edb_files' && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/macs2/86e2413cf3f8/macs2/dir2html.py' '/tmp/tmpamie7oua/job_working_directory/000/12/outputs/dataset_a071a297-cc44-43fc-b359-5ec505395edb_files' macs2_stderr > '/tmp/tmpamie7oua/job_working_directory/000/12/outputs/dataset_a071a297-cc44-43fc-b359-5ec505395edb.dat'; fi; ) && exit_code_for_galaxy=$? && cat macs2_stderr 2>&1 && (exit $exit_code_for_galaxy)
```
**Exit Code:**
* ```console
0
```
**Standard Output:**
* ```console
INFO @ Mon, 15 Jul 2024 04:51:00:
# Command line: callpeak -t /tmp/tmpamie7oua/files/7/f/c/dataset_7fcf7cc5-4b55-4677-a34e-4ec2913376a5.dat --name SRR891268_chr22_enriched --format BED --gsize 2700000000 --call-summits --keep-dup all --d-min 20 --buffer-size 100000 --bdg --qvalue 0.05 --nomodel --extsize 200 --shift -100
# ARGUMENTS LIST:
# name = SRR891268_chr22_enriched
# format = BED
# ChIP-seq file = ['/tmp/tmpamie7oua/files/7/f/c/dataset_7fcf7cc5-4b55-4677-a34e-4ec2913376a5.dat']
# control file = None
# effective genome size = 2.70e+09
# band width = 300
# model fold = [5, 50]
# qvalue cutoff = 5.00e-02
# The maximum gap between significant sites is assigned as the read length/tag size.
# The minimum length of peaks is assigned as the predicted fragment length "d".
# Larger dataset will be scaled towards smaller dataset.
# Range for calculating regional lambda is: 10000 bps
# Broad region calling is off
# Paired-End mode is off
# Searching for subpeak summits is on
INFO @ Mon, 15 Jul 2024 04:51:00: #1 read tag files...
INFO @ Mon, 15 Jul 2024 04:51:00: #1 read treatment tags...
INFO @ Mon, 15 Jul 2024 04:51:00: #1 tag size is determined as 47 bps
INFO @ Mon, 15 Jul 2024 04:51:00: #1 tag size = 47.0
INFO @ Mon, 15 Jul 2024 04:51:00: #1 total tags in treatment: 232804
INFO @ Mon, 15 Jul 2024 04:51:00: #1 finished!
INFO @ Mon, 15 Jul 2024 04:51:00: #2 Build Peak Model...
INFO @ Mon, 15 Jul 2024 04:51:00: #2 Skipped...
INFO @ Mon, 15 Jul 2024 04:51:00: #2 Use 200 as fragment length
INFO @ Mon, 15 Jul 2024 04:51:00: #2 Sequencing ends will be shifted towards 5' by 100 bp(s)
INFO @ Mon, 15 Jul 2024 04:51:00: #3 Call peaks...
INFO @ Mon, 15 Jul 2024 04:51:00: #3 Going to call summits inside each peak ...
INFO @ Mon, 15 Jul 2024 04:51:00: #3 Pre-compute pvalue-qvalue table...
INFO @ Mon, 15 Jul 2024 04:51:00: #3 In the peak calling step, the following will be performed simultaneously:
INFO @ Mon, 15 Jul 2024 04:51:00: #3 Write bedGraph files for treatment pileup (after scaling if necessary)... SRR891268_chr22_enriched_treat_pileup.bdg
INFO @ Mon, 15 Jul 2024 04:51:00: #3 Write bedGraph files for control lambda (after scaling if necessary)... SRR891268_chr22_enriched_control_lambda.bdg
INFO @ Mon, 15 Jul 2024 04:51:00: #3 Pileup will be based on sequencing depth in treatment.
INFO @ Mon, 15 Jul 2024 04:51:00: #3 Call peaks for each chromosome...
INFO @ Mon, 15 Jul 2024 04:51:01: #4 Write output xls file... SRR891268_chr22_enriched_peaks.xls
INFO @ Mon, 15 Jul 2024 04:51:01: #4 Write peak in narrowPeak format file... SRR891268_chr22_enriched_peaks.narrowPeak
INFO @ Mon, 15 Jul 2024 04:51:01: #4 Write summits bed file... SRR891268_chr22_enriched_summits.bed
INFO @ Mon, 15 Jul 2024 04:51:01: Done!
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| advanced\_options | ` {"broad_options": {"__current_case__": 1, "broad_options_selector": "nobroad", "call_summits": true}, "buffer_size": "100000", "d_min": "20", "keep_dup_options": {"__current_case__": 2, "keep_dup_options_selector": "all"}, "llocal": null, "nolambda": false, "ratio": null, "slocal": null, "spmr": false, "to_large": false} ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| control | ` {"__current_case__": 1, "c_select": "No"} ` |
| cutoff\_options | ` {"__current_case__": 1, "cutoff_options_selector": "qvalue", "qvalue": "0.05"} ` |
| dbkey | ` "hg19" ` |
| effective\_genome\_size\_options | ` {"__current_case__": 4, "effective_genome_size_options_selector": "user_defined", "gsize": "2700000000"} ` |
| format | ` "BED" ` |
| nomodel\_type | ` {"__current_case__": 1, "extsize": "200", "nomodel_type_selector": "nomodel", "shift": "-100"} ` |
| outputs | ` ["peaks_tabular", "summits", "bdg", "html"] ` |
| treatment | ` {"__current_case__": 0, "input_treatment_file": {"values": [{"id": 16, "src": "dce"}]}, "t_multi_select": "No"} ` |
</details>
- **Step 15: compute 1/million reads**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/6595517c2dd8/column_maker/column_maker.py' --column-types int --avoid-scientific-notation --file '/tmp/tmpamie7oua/job_working_directory/000/13/configs/tmpvdzo5g7f' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpamie7oua/files/c/b/a/dataset_cbacd990-6ad0-427e-98cd-5c15c1bbac03.dat' '/tmp/tmpamie7oua/job_working_directory/000/13/outputs/dataset_b843794d-49ea-460d-91c7-d9e83eca9735.dat'
```
**Exit Code:**
* ```console
0
```
**Standard Output:**
* ```console
Computing 0 new columns with instructions ['1000000/c1;1R;']
Computed new column values for 100.00% of 1 lines written.
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "tabular" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| avoid\_scientific\_notation | ` true ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| dbkey | ` "hg19" ` |
| error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
| ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 2, "mode": "R", "pos": "1"}, "cond": "1000000/c1"}], "header_lines_select": "no"} ` |
</details>
- **Step 16: Bigwig from MACS2 (no norm)**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
grep -v "^track" '/tmp/tmpamie7oua/files/3/c/f/dataset_3cfe6b65-4e65-419b-a6c8-ab033855cba0.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len' '/tmp/tmpamie7oua/job_working_directory/000/14/outputs/dataset_9119000b-5731-4160-8e50-6aa7df3af500.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "bedgraph" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| dbkey | ` "hg19" ` |
| settings | ` {"__current_case__": 0, "settingsType": "preset"} ` |
</details>
- **Step 17: get summits +/-500kb**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
bedtools slop -g '/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len' -i '/tmp/tmpamie7oua/files/5/7/1/dataset_57193210-ccaf-4f37-aa6c-ef63f108fcca.dat' -b 500 > '/tmp/tmpamie7oua/job_working_directory/000/15/outputs/dataset_4ec222d8-b3ea-4ef6-9bf4-ebf96155422d.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| addition | ` {"__current_case__": 0, "addition_select": "b", "b": "500"} ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| dbkey | ` "hg19" ` |
| genome\_file\_opts | ` {"__current_case__": 0, "genome": "hg19", "genome_file_opts_selector": "loc"} ` |
| header | ` false ` |
| pct | ` false ` |
| strand | ` false ` |
</details>
- **Step 18: summary of MACS2**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
grep -P -A 0 -B 0 --no-group-separator -i -- '^#' '/tmp/tmpamie7oua/files/5/8/c/dataset_58c08a79-21f4-4508-a02e-0995e093676b.dat' > '/tmp/tmpamie7oua/job_working_directory/000/16/outputs/dataset_f22937b6-2e78-4fd6-9fee-a74d5491eeab.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| case\_sensitive | ` "-i" ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| color | ` "NOCOLOR" ` |
| dbkey | ` "hg19" ` |
| invert | ` "" ` |
| lines\_after | ` "0" ` |
| lines\_before | ` "0" ` |
| regex\_type | ` "-P" ` |
| url\_paste | ` "^#" ` |
</details>
- **Step 19: Convert 1/million reads to parameter**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
cd ../; python _evaluate_expression_.py
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "tabular" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| dbkey | ` "hg19" ` |
| param\_type | ` "text" ` |
| remove\_newlines | ` true ` |
</details>
- **Step 20: Isolate each bigwig do normalize not average**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| input | ` {"values": [{"id": 23, "src": "hdca"}]} ` |
| rules | ` {"mapping": [{"collapsible_value": {"__class__": "RuntimeValue"}, "columns": [0, 1], "connectable": true, "editing": false, "is_workflow": false, "type": "list_identifiers"}], "rules": [{"collapsible_value": {"__class__": "RuntimeValue"}, "connectable": true, "error": null, "is_workflow": false, "type": "add_column_metadata", "value": "identifier0", "warn": null}, {"collapsible_value": {"__class__": "RuntimeValue"}, "connectable": true, "error": null, "is_workflow": false, "type": "add_column_metadata", "value": "identifier0", "warn": null}]} ` |
</details>
- **Step 3: effective_genome_size**:
* step_state: scheduled
- **Step 21: Merge summits +/-500kb**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
mergeBed -i '/tmp/tmpamie7oua/files/4/e/c/dataset_4ec222d8-b3ea-4ef6-9bf4-ebf96155422d.dat' -d 0 > '/tmp/tmpamie7oua/job_working_directory/000/18/outputs/dataset_92633c59-224d-4701-94fc-5755992f7dc9.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| c\_and\_o\_argument\_repeat | ` [] ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| dbkey | ` "hg19" ` |
| distance | ` "0" ` |
| header | ` false ` |
| strand | ` "" ` |
</details>
- **Step 22: normalize by million reads**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
bigwigAverage --numberOfProcessors "${GALAXY_SLOTS:-4}" --bigwigs /tmp/tmpamie7oua/files/9/1/1/dataset_9119000b-5731-4160-8e50-6aa7df3af500.dat --outFileName '/tmp/tmpamie7oua/job_working_directory/000/27/outputs/dataset_d71cde8e-15f6-415a-852a-b4c49e2b685b.dat' --outFileFormat 'bigwig' --scaleFactors '4.295458840913386' --binSize 1000
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| advancedOpt | ` {"__current_case__": 1, "binSize": "1000", "blackListFileName": null, "scaleFactors": "4.295458840913386", "showAdvancedOpt": "yes", "skipNAs": false} ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| dbkey | ` "hg19" ` |
| outFileFormat | ` "bigwig" ` |
| region | ` "" ` |
</details>
- **Step 23: Compute coverage on summits +/-500kb**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
bedtools coverage -a '/tmp/tmpamie7oua/files/9/2/6/dataset_92633c59-224d-4701-94fc-5755992f7dc9.dat' -b '/tmp/tmpamie7oua/files/e/0/b/dataset_e0b07879-5fe1-4901-91c0-b3630bf3c6f1.dat' | sort -k1,1 -k2,2n > '/tmp/tmpamie7oua/job_working_directory/000/19/outputs/dataset_6ca6b3f1-b0b7-429b-a1c2-6179331dcf1d.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| a\_or\_b | ` false ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| d | ` false ` |
| dbkey | ` "hg19" ` |
| hist | ` false ` |
| mean | ` false ` |
| overlap\_a | ` None ` |
| overlap\_b | ` None ` |
| reciprocal\_overlap | ` false ` |
| reduce\_or\_iterate | ` {"__current_case__": 0, "inputB": {"values": [{"id": 14, "src": "dce"}]}, "reduce_or_iterate_selector": "iterate"} ` |
| sorted | ` false ` |
| split | ` false ` |
| strandedness | ` false ` |
</details>
- **Step 24: number of reads in peaks**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
env -i $(which awk) --sandbox -v FS=' ' -v OFS=' ' --re-interval -f '/tmp/tmpamie7oua/job_working_directory/000/20/configs/tmpy_s95xi1' '/tmp/tmpamie7oua/files/6/c/a/dataset_6ca6b3f1-b0b7-429b-a1c2-6179331dcf1d.dat' > '/tmp/tmpamie7oua/job_working_directory/000/20/outputs/dataset_b41c4dac-2dc5-45f3-9358-7c0912872ea2.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| code | ` "{S=S+$4}END{print S}" ` |
| dbkey | ` "hg19" ` |
</details>
- **Step 25: compute 1/million reads in peaks**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/6595517c2dd8/column_maker/column_maker.py' --column-types int --avoid-scientific-notation --file '/tmp/tmpamie7oua/job_working_directory/000/21/configs/tmpmv9z6q9q' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpamie7oua/files/b/4/1/dataset_b41c4dac-2dc5-45f3-9358-7c0912872ea2.dat' '/tmp/tmpamie7oua/job_working_directory/000/21/outputs/dataset_29ba7af1-56f8-4bd1-b7d3-5374addc3f08.dat'
```
**Exit Code:**
* ```console
0
```
**Standard Output:**
* ```console
Computing 0 new columns with instructions ['1000000/c1;1R;']
Computed new column values for 100.00% of 1 lines written.
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "tabular" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| avoid\_scientific\_notation | ` true ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| dbkey | ` "hg19" ` |
| error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
| ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 2, "mode": "R", "pos": "1"}, "cond": "1000000/c1"}], "header_lines_select": "no"} ` |
</details>
- **Step 26: Combine number of reads in peaks with total number of reads**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
python /tmp/tmpamie7oua/galaxy-dev/tools/filters/catWrapper.py '/tmp/tmpamie7oua/job_working_directory/000/22/outputs/dataset_031d35fe-0630-4f89-a9bd-0bf24986eba8.dat' '/tmp/tmpamie7oua/files/b/4/1/dataset_b41c4dac-2dc5-45f3-9358-7c0912872ea2.dat' '/tmp/tmpamie7oua/files/c/b/a/dataset_cbacd990-6ad0-427e-98cd-5c15c1bbac03.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "tabular" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| dbkey | ` "hg19" ` |
| queries | ` [{"__index__": 0, "input2": {"values": [{"id": 19, "src": "dce"}]}}] ` |
</details>
- **Step 27: Convert 1/million reads in peaks to parameter**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
cd ../; python _evaluate_expression_.py
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "tabular" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| dbkey | ` "hg19" ` |
| param\_type | ` "text" ` |
| remove\_newlines | ` true ` |
</details>
- **Step 28: reads in peaks multiQC**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
env -i $(which awk) --sandbox -v FS=' ' -v OFS=' ' --re-interval -f '/tmp/tmpamie7oua/job_working_directory/000/24/configs/tmprf46y803' '/tmp/tmpamie7oua/files/0/3/1/dataset_031d35fe-0630-4f89-a9bd-0bf24986eba8.dat' > '/tmp/tmpamie7oua/job_working_directory/000/24/outputs/dataset_fea91242-1875-4ee8-8b4b-0d4dd1961078.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| code | ` " NR==1{print \"in peaks\",$1;inp=$1}NR==2{print \"outside peaks\",$1 - inp}" ` |
| dbkey | ` "hg19" ` |
</details>
- **Step 29: normalize by million reads in peaks**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
bigwigAverage --numberOfProcessors "${GALAXY_SLOTS:-4}" --bigwigs /tmp/tmpamie7oua/files/9/1/1/dataset_9119000b-5731-4160-8e50-6aa7df3af500.dat --outFileName '/tmp/tmpamie7oua/job_working_directory/000/28/outputs/dataset_bf65d3fa-ed95-4526-9618-37ff453f6cb5.dat' --outFileFormat 'bigwig' --scaleFactors '114.96895838123707' --binSize 1000
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| advancedOpt | ` {"__current_case__": 1, "binSize": "1000", "blackListFileName": null, "scaleFactors": "114.96895838123707", "showAdvancedOpt": "yes", "skipNAs": false} ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| dbkey | ` "hg19" ` |
| outFileFormat | ` "bigwig" ` |
| region | ` "" ` |
</details>
- **Step 30: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
die() { echo "$@" 1>&2 ; exit 1; } && mkdir multiqc_WDir && mkdir multiqc_WDir/cutadapt_0 && ln -s '/tmp/tmpamie7oua/files/a/b/2/dataset_ab251f01-6877-4449-a8c8-5f006c2d62e6.dat' 'multiqc_WDir/cutadapt_0/SRR891268_chr22_enriched.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/SRR891268_chr22_enriched.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/SRR891268_chr22_enriched.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" && mkdir multiqc_WDir/bowtie2_1 && grep -q '% overall alignment rate' /tmp/tmpamie7oua/files/c/0/7/dataset_c07338d3-bc85-46c7-b3bf-798380d884cf.dat || die "Module 'bowtie2: '% overall alignment rate' not found in the file 'SRR891268_chr22_enriched'" && ln -s '/tmp/tmpamie7oua/files/c/0/7/dataset_c07338d3-bc85-46c7-b3bf-798380d884cf.dat' 'multiqc_WDir/bowtie2_1/SRR891268_chr22_enriched' && mkdir multiqc_WDir/custom_content_2 && ln -s '/tmp/tmpamie7oua/files/4/8/8/dataset_4880640e-d2f4-4077-a381-23bfc0963a33.dat' 'multiqc_WDir/custom_content_2/file_2_0' && more /tmp/tmpamie7oua/files/4/8/8/dataset_4880640e-d2f4-4077-a381-23bfc0963a33.dat && mkdir multiqc_WDir/picard_3 && mkdir 'multiqc_WDir/picard_3/markdups_0' && grep -q 'MarkDuplicates' /tmp/tmpamie7oua/files/4/1/7/dataset_417c9336-858c-42ae-9985-f25ec595fddc.dat || die "Module 'picard: 'MarkDuplicates' not found in the file 'SRR891268_chr22_enriched'" && ln -s '/tmp/tmpamie7oua/files/4/1/7/dataset_417c9336-858c-42ae-9985-f25ec595fddc.dat' 'multiqc_WDir/picard_3/markdups_0/SRR891268_chr22_enriched' && mkdir multiqc_WDir/custom_content_4 && ln -s '/tmp/tmpamie7oua/files/d/9/3/dataset_d932cd06-612d-487d-92db-be3073a6fc82.dat' 'multiqc_WDir/custom_content_4/file_4_0' && more /tmp/tmpamie7oua/files/d/9/3/dataset_d932cd06-612d-487d-92db-be3073a6fc82.dat && mkdir multiqc_WDir/macs2_5 && grep -q "# This file is generated by MACS" /tmp/tmpamie7oua/files/5/8/c/dataset_58c08a79-21f4-4508-a02e-0995e093676b.dat || die "'# This file is generated by MACS' not found in the file" && ln -s '/tmp/tmpamie7oua/files/5/8/c/dataset_58c08a79-21f4-4508-a02e-0995e093676b.dat' 'multiqc_WDir/macs2_5/SRR891268_chr22_enriched_peaks.xls' && mkdir multiqc_WDir/custom_content_6 && ln -s '/tmp/tmpamie7oua/files/f/e/a/dataset_fea91242-1875-4ee8-8b4b-0d4dd1961078.dat' 'multiqc_WDir/custom_content_6/file_6_0' && more /tmp/tmpamie7oua/files/f/e/a/dataset_fea91242-1875-4ee8-8b4b-0d4dd1961078.dat && multiqc multiqc_WDir --filename 'report' --export --config '/tmp/tmpamie7oua/job_working_directory/000/25/configs/tmpn1y608jb'
```
**Exit Code:**
* ```console
0
```
**Standard Error:**
* ```console
/// MultiQC 🔍 | v1.11
| multiqc | MultiQC Version v1.23 now available!
| multiqc | Search path : /tmp/tmpamie7oua/job_working_directory/000/25/working/multiqc_WDir
| custom_content | Could not parse comment file header for MultiQC custom content: file_4_0
| custom_content | section_2: Found 1 samples (bargraph)
| custom_content | section_4: Found 1 samples (linegraph)
| custom_content | section_6: Found 1 samples (bargraph)
| macs2 | Found 1 logs
| picard | Found 1 MarkDuplicates reports
| bowtie2 | Found 1 reports
| cutadapt | Found 1 reports
| multiqc | Compressing plot data
| multiqc | Report : report.html
| multiqc | Data : report_data
| multiqc | Plots : report_plots
| multiqc | MultiQC complete
```
**Standard Output:**
* ```console
::::::::::::::
/tmp/tmpamie7oua/files/4/8/8/dataset_4880640e-d2f4-4077-a381-23bfc0963a33.dat
::::::::::::::
chrM 216347
others 339454
::::::::::::::
/tmp/tmpamie7oua/files/d/9/3/dataset_d932cd06-612d-487d-92db-be3073a6fc82.dat
::::::::::::::
# localbam.bam
# Chromosome_ID Chromosome_Size Aligned_Reads
# chr10 135534747 5214.0
# chr11 135006516 5674.0
# chr11_gl000202_random 40103 0.0
# chr12 133851895 5404.0
# chr13 115169878 3794.0
# chr14 107349540 3422.0
# chr15 102531392 2518.0
# chr16 90354753 3218.0
# chr17_ctg5_hap1 1680828 0.0
# chr17 81195210 2880.0
# chr17_gl000203_random 37498 0.0
# chr17_gl000204_random 81310 0.0
# chr17_gl000205_random 174588 42.0
# chr17_gl000206_random 41001 0.0
# chr18 78077248 3012.0
# chr18_gl000207_random 4262 0.0
# chr19 59128983 2580.0
# chr19_gl000208_random 92689 2.0
# chr19_gl000209_random 159169 0.0
# chr1 249250621 9842.0
# chr1_gl000191_random 106433 2.0
# chr1_gl000192_random 547496 4.0
# chr20 63025520 2366.0
# chr21 48129895 1214.0
# chr21_gl000210_random 27682 0.0
# chr22 51304566 116840.0
# chr2 243199373 10050.0
# chr3 198022430 8394.0
# chr4_ctg9_hap1 590426 0.0
# chr4 191154276 8172.0
# chr4_gl000193_random 189789 2.0
# chr4_gl000194_random 191469 4.0
# chr5 180915260 7536.0
# chr6_apd_hap1 4622290 0.0
# chr6_cox_hap2 4795371 2.0
# chr6_dbb_hap3 4610396 0.0
# chr6 171115067 7054.0
# chr6_mann_hap4 4683263 2.0
# chr6_mcf_hap5 4833398 0.0
# chr6_qbl_hap6 4611984 0.0
# chr6_ssto_hap7 4928567 0.0
# chr7 159138663 6548.0
# chr7_gl000195_random 182896 16.0
# chr8 146364022 6326.0
# chr8_gl000196_random 38914 0.0
# chr8_gl000197_random 37175 0.0
# chr9 141213431 4420.0
# chr9_gl000198_random 90085 22.0
# chr9_gl000199_random 169874 2.0
# chr9_gl000200_random 187035 0.0
# chr9_gl000201_random 36148 0.0
# chrM 16571 0.0
# chrUn_gl000211 166566 6.0
# chrUn_gl000212 186858 2.0
# chrUn_gl000213 164239 0.0
# chrUn_gl000214 137718 10.0
# chrUn_gl000215 172545 0.0
# chrUn_gl000216 172294 2.0
# chrUn_gl000217 172149 24.0
# chrUn_gl000218 161147 0.0
# chrUn_gl000219 179198 10.0
# chrUn_gl000220 161802 236.0
# chrUn_gl000221 155397 2.0
# chrUn_gl000222 186861 0.0
# chrUn_gl000223 180455 0.0
# chrUn_gl000224 179693 8.0
# chrUn_gl000225 211173 8.0
# chrUn_gl000226 15008 6.0
# chrUn_gl000227 128374 0.0
# chrUn_gl000228 129120 0.0
# chrUn_gl000229 19913 82.0
# chrUn_gl000230 43691 8.0
# chrUn_gl000231 27386 84.0
# chrUn_gl000232 40652 158.0
# chrUn_gl000233 45941 32.0
# chrUn_gl000234 40531 122.0
# chrUn_gl000235 34474 50.0
# chrUn_gl000236 41934 0.0
# chrUn_gl000237 45867 66.0
# chrUn_gl000238 39939 2.0
# chrUn_gl000239 33824 2.0
# chrUn_gl000240 41933 12.0
# chrUn_gl000241 42152 118.0
# chrUn_gl000242 43523 10.0
# chrUn_gl000243 43341 12.0
# chrUn_gl000244 39929 0.0
# chrUn_gl000245 36651 2.0
# chrUn_gl000246 38154 6.0
# chrUn_gl000247 36422 0.0
# chrUn_gl000248 39786 6.0
# chrUn_gl000249 38502 0.0
# chrX 155270560 5134.0
# chrY 59373566 6.0
# Total Genome Size: 3.137161264E9 Total Aligned Tags: 232804.0
# bowtie2 # 2.5.3
# "/usr/local/bin/bowtie2-align-s --wrapper basic-0 -p 1 -x /cvmfs/data.galaxyproject.org/byhand/hg19/hg19full/bowtie2_index/hg19full --very-sensitive -1 input_f.fastq -2 input_r.fastq"
# samtools # 1.19.2
# samtools sort -l 0 -T /tmp/tmpamie7oua/tmp -O bam
# MarkDuplicates # Version:3.1.1
# MarkDuplicates --TAGGING_POLICY All --INPUT SRR891268_chr22_enriched --OUTPUT /tmp/tmpamie7oua/job_working_directory/000/7/outputs/dataset_e0b07879-5fe1-4901-91c0-b3630bf3c6f1.dat --METRICS_FILE /tmp/tmpamie7oua/job_working_directory/000/7/outputs/dataset_417c9336-858c-42ae-9985-f25ec595fddc.dat --REMOVE_DUPLICATES true --ASSUME_SORTED true --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --VERBOSITY ERROR --QUIET true --VALIDATION_STRINGENCY LENIENT --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX <optimized capture of last three ':' separated fields as numeric values> --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false
# Average Insert Size: 162.46371196371197
# Median Insert Size: 126.0
# Std deviation of Insert Size: 117.9037267671474
# Number of ReadPairs: 116402.0
# Histogram
# Size (bp) Frequency
0 0.0
1 0.0
2 0.0
3 0.0
4 0.0
5 0.0
6 0.0
7 0.0
8 0.0
9 0.0
10 0.0
11 0.0
12 0.0
13 0.0
14 0.0
15 0.0
16 0.0
17 0.0
18 0.0
19 0.0
20 0.0
21 0.0
22 0.0
23 1.0
24 1.0
25 11.0
26 142.0
27 117.0
28 131.0
29 130.0
30 90.0
31 88.0
32 101.0
33 116.0
34 199.0
35 385.0
36 613.0
37 761.0
38 827.0
39 1076.0
40 1305.0
41 1453.0
42 1503.0
43 1415.0
44 1214.0
45 1206.0
46 1057.0
47 969.0
48 14.0
49 19.0
50 1190.0
51 1450.0
52 1335.0
53 1142.0
54 1041.0
55 1022.0
56 934.0
57 779.0
58 759.0
59 711.0
60 711.0
61 880.0
62 926.0
63 835.0
64 905.0
65 885.0
66 765.0
67 697.0
68 651.0
69 598.0
70 638.0
71 717.0
72 749.0
73 770.0
74 736.0
75 677.0
76 653.0
77 578.0
78 569.0
79 530.0
80 508.0
81 594.0
82 631.0
83 584.0
84 605.0
85 579.0
86 593.0
87 544.0
88 487.0
89 439.0
90 395.0
91 420.0
92 469.0
93 512.0
94 484.0
95 502.0
96 473.0
97 431.0
98 380.0
99 348.0
100 350.0
101 380.0
102 343.0
103 371.0
104 420.0
105 410.0
106 414.0
107 364.0
108 363.0
109 301.0
110 281.0
111 314.0
112 306.0
113 337.0
114 331.0
115 321.0
116 329.0
117 352.0
118 293.0
119 276.0
120 261.0
121 261.0
122 254.0
123 266.0
124 250.0
125 263.0
126 294.0
127 265.0
128 256.0
129 261.0
130 250.0
131 234.0
132 209.0
133 245.0
134 253.0
135 238.0
136 272.0
137 304.0
138 288.0
139 287.0
140 248.0
141 238.0
142 225.0
143 193.0
144 221.0
145 219.0
146 226.0
147 266.0
148 238.0
149 240.0
150 268.0
151 267.0
152 255.0
153 258.0
154 212.0
155 221.0
156 229.0
157 249.0
158 256.0
159 267.0
160 228.0
161 239.0
162 255.0
163 221.0
164 232.0
165 300.0
166 330.0
167 387.0
168 371.0
169 345.0
170 288.0
171 299.0
172 251.0
173 251.0
174 303.0
175 353.0
176 370.0
177 383.0
178 421.0
179 351.0
180 289.0
181 321.0
182 270.0
183 270.0
184 322.0
185 315.0
186 324.0
187 339.0
188 348.0
189 334.0
190 305.0
191 309.0
192 291.0
193 303.0
194 323.0
195 374.0
196 348.0
197 343.0
198 306.0
199 317.0
200 308.0
201 314.0
202 307.0
203 340.0
204 349.0
205 336.0
206 340.0
207 342.0
208 314.0
209 287.0
210 330.0
211 340.0
212 297.0
213 318.0
214 272.0
215 321.0
216 336.0
217 324.0
218 347.0
219 297.0
220 314.0
221 285.0
222 286.0
223 270.0
224 305.0
225 307.0
226 287.0
227 283.0
228 289.0
229 256.0
230 284.0
231 275.0
232 265.0
233 250.0
234 256.0
235 239.0
236 226.0
237 237.0
238 225.0
239 232.0
240 214.0
241 221.0
242 235.0
243 211.0
244 170.0
245 202.0
246 218.0
247 214.0
248 178.0
249 158.0
250 185.0
251 175.0
252 158.0
253 181.0
254 192.0
255 172.0
256 143.0
257 140.0
258 156.0
259 159.0
260 143.0
261 126.0
262 160.0
263 126.0
264 128.0
265 132.0
266 139.0
267 109.0
268 134.0
269 110.0
270 122.0
271 116.0
272 126.0
273 96.0
274 120.0
275 119.0
276 123.0
277 120.0
278 125.0
279 95.0
280 99.0
281 124.0
282 113.0
283 121.0
284 113.0
285 79.0
286 88.0
287 89.0
288 105.0
289 105.0
290 101.0
291 82.0
292 100.0
293 104.0
294 97.0
295 102.0
296 95.0
297 102.0
298 96.0
299 98.0
300 98.0
301 109.0
302 115.0
303 96.0
304 85.0
305 75.0
306 84.0
307 94.0
308 119.0
309 81.0
310 98.0
311 94.0
312 101.0
313 95.0
314 87.0
315 93.0
316 102.0
317 77.0
318 91.0
319 104.0
320 100.0
321 92.0
322 82.0
323 76.0
324 82.0
325 106.0
326 101.0
327 92.0
328 83.0
329 86.0
330 91.0
331 98.0
332 78.0
333 79.0
334 98.0
335 79.0
336 93.0
337 92.0
338 94.0
339 88.0
340 77.0
341 95.0
342 89.0
343 112.0
344 90.0
345 119.0
346 106.0
347 108.0
348 113.0
349 77.0
350 95.0
351 95.0
352 96.0
353 99.0
354 97.0
355 118.0
356 92.0
357 101.0
358 99.0
359 90.0
360 103.0
361 103.0
362 109.0
363 119.0
364 117.0
365 105.0
366 123.0
367 115.0
368 121.0
369 123.0
370 112.0
371 121.0
372 115.0
373 94.0
374 116.0
375 113.0
376 106.0
377 112.0
378 103.0
379 113.0
380 104.0
381 105.0
382 114.0
383 109.0
384 110.0
385 107.0
386 110.0
387 113.0
388 115.0
389 128.0
390 130.0
391 112.0
392 128.0
393 95.0
394 119.0
395 111.0
396 109.0
397 111.0
398 115.0
399 103.0
400 106.0
401 113.0
402 107.0
403 118.0
404 103.0
405 93.0
406 111.0
407 113.0
408 130.0
409 106.0
410 102.0
411 97.0
412 92.0
413 112.0
414 101.0
415 96.0
416 93.0
417 89.0
418 102.0
419 96.0
420 98.0
421 108.0
422 92.0
423 95.0
424 80.0
425 76.0
426 103.0
427 90.0
428 80.0
429 82.0
430 94.0
431 93.0
432 84.0
433 77.0
434 91.0
435 90.0
436 72.0
437 78.0
438 71.0
439 66.0
440 77.0
441 80.0
442 78.0
443 68.0
444 63.0
445 71.0
446 70.0
447 78.0
448 56.0
449 61.0
450 59.0
451 60.0
452 49.0
453 59.0
454 65.0
455 73.0
456 56.0
457 50.0
458 72.0
459 52.0
460 60.0
461 67.0
462 57.0
463 61.0
464 53.0
465 50.0
466 52.0
467 58.0
468 44.0
469 64.0
470 52.0
471 57.0
472 47.0
473 63.0
474 48.0
475 53.0
476 57.0
477 41.0
478 49.0
479 50.0
480 60.0
481 46.0
482 42.0
483 51.0
484 47.0
485 35.0
486 40.0
487 41.0
488 51.0
489 44.0
490 36.0
491 37.0
492 48.0
493 52.0
494 49.0
495 52.0
496 56.0
497 50.0
498 42.0
499 49.0
500 46.0
::::::::::::::
/tmp/tmpamie7oua/files/f/e/a/dataset_fea91242-1875-4ee8-8b4b-0d4dd1961078.dat
::::::::::::::
in peaks 8698
outside peaks 224106
| searching | ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 100% 8/8
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| comment | ` "" ` |
| dbkey | ` "hg19" ` |
| export | ` true ` |
| flat | ` false ` |
| results | ` [{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}, {"__index__": 1, "software_cond": {"__current_case__": 3, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 32, "description": "", "input": {"values": [{"id": 11, "src": "hdca"}]}, "plot_type": "bargraph", "section_name": "chrM", "software": "custom_content", "title": "reads mapping on chrM", "xlab": "", "ylab": ""}}, {"__index__": 3, "software_cond": {"__current_case__": 17, "output": [{"__index__": 0, "input": {"values": [{"id": 9, "src": "hdca"}]}, "type": "markdups"}], "software": "picard"}}, {"__index__": 4, "software_cond": {"__current_case__": 32, "description": "", "input": {"values": [{"id": 14, "src": "hdca"}]}, "plot_type": "linegraph", "section_name": "Fragment size", "software": "custom_content", "title": "Fragment size distribution", "xlab": "", "ylab": ""}}, {"__index__": 5, "software_cond": {"__current_case__": 16, "input": {"values": [{"id": 16, "src": "hdca"}]}, "software": "macs2"}}, {"__index__": 6, "software_cond": {"__current_case__": 32, "description": "Number of reads falling 500bp from a summit", "input": {"values": [{"id": 33, "src": "hdca"}]}, "plot_type": "bargraph", "section_name": "Reads in peaks", "software": "custom_content", "title": "Number of reads in peaks", "xlab": "", "ylab": ""}}] ` |
| saveLog | ` false ` |
| title | ` "" ` |
</details>
- **Step 4: bin_size**:
* step_state: scheduled
- **Step 5: Cutadapt (remove adapter + bad quality bases)**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
ln -f -s '/tmp/tmpamie7oua/files/7/d/2/dataset_7d2cdf29-209c-4354-ac57-a260ffefd150.dat' 'SRR891268_chr22_enriched_1.fq' && ln -f -s '/tmp/tmpamie7oua/files/6/4/8/dataset_64850505-55d5-4e39-8a9f-6790b172dc96.dat' 'SRR891268_chr22_enriched_2.fq' && cutadapt -j=${GALAXY_SLOTS:-4} -a 'Nextera R1'='CTGTCTCTTATACACATCTCCGAGCCCACGAGAC' -A 'Nextera R2'='CTGTCTCTTATACACATCTGACGCTGCCGACGA' --error-rate=0.1 --times=1 --overlap=3 --action=trim --quality-cutoff=30 --minimum-length=15 -o 'out1.fq' -p 'out2.fq' 'SRR891268_chr22_enriched_1.fq' 'SRR891268_chr22_enriched_2.fq' > report.txt
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| adapter\_options | ` {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"} ` |
| chromInfo | ` "/tmp/tmpamie7oua/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| filter\_options | ` {"discard_casava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "15", "minimum_length2": null, "pair_filter": "any"} ` |
| library | ` {"__current_case__": 2, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "pair_adapters": false, "r1": {"adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "CTGTCTCTTATACACATCTCCGAGCCCACGAGAC", "adapter_name": "Nextera R1", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters": [], "front_adapters": []}, "r2": {"adapters2": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "CTGTCTCTTATACACATCTGACGCTGCCGACGA", "adapter_name": "Nextera R2", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters2": [], "front_adapters2": []}, "type": "paired_collection"} ` |
| other\_trimming\_options | ` {"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "30", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false} ` |
| output\_selector | ` ["report"] ` |
| read\_mod\_options | ` {"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false} ` |
</details>
- **Step 6: Bowtie2 map on reference**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
set -o | grep -q pipefail && set -o pipefail; ln -f -s '/tmp/tmpamie7oua/files/8/8/a/dataset_88aee1cb-c438-4fa8-addb-33fd31e00f1a.dat' input_f.fastq && ln -f -s '/tmp/tmpamie7oua/files/7/1/5/dataset_715c1bca-96cd-4eb8-a73e-28edb60c990d.dat' input_r.fastq && THREADS=${GALAXY_SLOTS:-4} && if [ "$THREADS" -gt 1 ]; then (( THREADS-- )); fi && bowtie2 -p "$THREADS" -x '/cvmfs/data.galaxyproject.org/byhand/hg19/hg19full/bowtie2_index/hg19full' -1 'input_f.fastq' -2 'input_r.fastq' --very-sensitive 2> >(tee '/tmp/tmpamie7oua/job_working_directory/000/4/outputs/dataset_c07338d3-bc85-46c7-b3bf-798380d884cf.dat' >&2) | samtools sort -l 0 -T "${TMPDIR:-.}" -O bam | samtools view --no-PG -O bam -@ ${GALAXY_SLOTS:-1} -o '/tmp/tmpamie7oua/job_working_directory/000/4/outputs/dataset_08851ecd-a9e7-4f41-91c5-02a131cd7eef.dat'
```
**Exit Code:**
* ```console
0
```
**Standard Error:**
* ```console
280964 reads; of these:
280964 (100.00%) were paired; of these:
30410 (10.82%) aligned concordantly 0 times
109333 (38.91%) aligned concordantly exactly 1 time
141221 (50.26%) aligned concordantly >1 times
----
30410 pairs aligned concordantly 0 times; of these:
13319 (43.80%) aligned discordantly 1 time
----
17091 pairs aligned 0 times concordantly or discordantly; of these:
34182 mates make up the pairs; of these:
6127 (17.92%) aligned 0 times
6515 (19.06%) aligned exactly 1 time
21540 (63.02%) aligned >1 times
98.91% overall alignment rate
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_job\_resource | ` {"__current_case__": 0, "__job_resource__select": "no"} ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| analysis\_type | ` {"__current_case__": 0, "analysis_type_selector": "simple", "presets": "--very-sensitive"} ` |
| chromInfo | ` "/tmp/tmpamie7oua/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
| dbkey | ` "?" ` |
| library | ` {"__current_case__": 2, "aligned_file": false, "input_1": {"values": [{"id": 4, "src": "dce"}]}, "paired_options": {"__current_case__": 1, "paired_options_selector": "no"}, "type": "paired_collection", "unaligned_file": false} ` |
| reference\_genome | ` {"__current_case__": 0, "index": "hg19", "source": "indexed"} ` |
| rg | ` {"__current_case__": 3, "rg_selector": "do_not_set"} ` |
| sam\_options | ` {"__current_case__": 1, "sam_options_selector": "no"} ` |
| save\_mapping\_stats | ` true ` |
</details>
- **Step 7: filter MAPQ30 concordant pairs and not mitochondrial pairs**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
cp '/tmp/tmpamie7oua/job_working_directory/000/5/configs/tmplnudtnc6' '/tmp/tmpamie7oua/job_working_directory/000/5/outputs/dataset_4c4d0a34-5fcb-401c-978a-1ae946eba1e7.dat' && ln -s '/tmp/tmpamie7oua/files/0/8/8/dataset_08851ecd-a9e7-4f41-91c5-02a131cd7eef.dat' localbam.bam && ln -s '/tmp/tmpamie7oua/files/_metadata_files/a/b/6/metadata_ab67234b-d9de-463a-810e-335f1f73ee46.dat' localbam.bam.bai && cat '/tmp/tmpamie7oua/job_working_directory/000/5/configs/tmplnudtnc6' && bamtools filter -script '/tmp/tmpamie7oua/job_working_directory/000/5/configs/tmplnudtnc6' -in localbam.bam -out '/tmp/tmpamie7oua/job_working_directory/000/5/outputs/dataset_863be7be-3d8a-4702-ac09-2f5652514748.dat'
```
**Exit Code:**
* ```console
0
```
**Standard Output:**
* ```console
{
"filters": [
{
"id": "1",
"mapQuality": ">=30",
"isProperPair": "true",
"reference": "!chrM",
"mateReference": "!MT"
}
],
"rule": ""
}
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "bam" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| conditions | ` [{"__index__": 0, "filters": [{"__index__": 0, "bam_property": {"__current_case__": 14, "bam_property_selector": "mapQuality", "bam_property_value": ">=30"}}, {"__index__": 1, "bam_property": {"__current_case__": 11, "bam_property_selector": "isProperPair", "bam_property_value": true}}, {"__index__": 2, "bam_property": {"__current_case__": 20, "bam_property_selector": "reference", "bam_property_value": "!chrM"}}, {"__index__": 3, "bam_property": {"__current_case__": 16, "bam_property_selector": "mateReference", "bam_property_value": "!MT"}}]}] ` |
| dbkey | ` "hg19" ` |
| rule\_configuration | ` {"__current_case__": 1, "rules": null, "rules_selector": "true"} ` |
</details>
- **Step 8: Get number of reads per chromosome**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
addthreads=${GALAXY_SLOTS:-1} && (( addthreads-- )) && ln -s '/tmp/tmpamie7oua/files/0/8/8/dataset_08851ecd-a9e7-4f41-91c5-02a131cd7eef.dat' infile && ln -s '/tmp/tmpamie7oua/files/_metadata_files/a/b/6/metadata_ab67234b-d9de-463a-810e-335f1f73ee46.dat' infile.bai && samtools idxstats -@ $addthreads infile > '/tmp/tmpamie7oua/job_working_directory/000/6/outputs/dataset_67e1a239-f171-4be2-90aa-e72dc5d5e304.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| dbkey | ` "hg19" ` |
</details>
- **Step 9: remove PCR duplicates**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
_JAVA_OPTIONS=${_JAVA_OPTIONS:-"-Xmx2048m -Xms256m -Djava.io.tmpdir=${TMPDIR:-${_GALAXY_JOB_TMPDIR}}"} && export _JAVA_OPTIONS && ln -sf '/tmp/tmpamie7oua/files/8/6/3/dataset_863be7be-3d8a-4702-ac09-2f5652514748.dat' 'SRR891268_chr22_enriched' && picard MarkDuplicates --INPUT 'SRR891268_chr22_enriched' --OUTPUT '/tmp/tmpamie7oua/job_working_directory/000/7/outputs/dataset_e0b07879-5fe1-4901-91c0-b3630bf3c6f1.dat' --METRICS_FILE '/tmp/tmpamie7oua/job_working_directory/000/7/outputs/dataset_417c9336-858c-42ae-9985-f25ec595fddc.dat' --REMOVE_DUPLICATES 'true' --ASSUME_SORTED 'true' --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --OPTICAL_DUPLICATE_PIXEL_DISTANCE '100' --VALIDATION_STRINGENCY 'LENIENT' --TAGGING_POLICY All --QUIET true --VERBOSITY ERROR
```
**Exit Code:**
* ```console
0
```
**Standard Error:**
* ```console
/usr/local/bin/picard: line 5: warning: setlocale: LC_ALL: cannot change locale (en_US.UTF-8): No such file or directory
Picked up _JAVA_OPTIONS: -Xmx2048m -Xms256m -Djava.io.tmpdir=/tmp/tmpamie7oua/tmp
Jul 15, 2024 4:50:12 AM com.intel.gkl.NativeLibraryLoader load
INFO: Loading libgkl_compression.so from jar:file:/usr/local/share/picard-3.1.1-0/picard.jar!/com/intel/gkl/native/libgkl_compression.so
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| assume\_sorted | ` true ` |
| barcode\_tag | ` "" ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| comments | ` [] ` |
| dbkey | ` "hg19" ` |
| duplicate\_scoring\_strategy | ` "SUM_OF_BASE_QUALITIES" ` |
| optical\_duplicate\_pixel\_distance | ` "100" ` |
| read\_name\_regex | ` "" ` |
| remove\_duplicates | ` true ` |
| validation\_stringency | ` "LENIENT" ` |
</details>
- **Step 10: reads in chrM/MT for multiQC**:
* step_state: scheduled
* <details><summary>Jobs</summary>
- **Job 1:**
* Job state is ok
**Command Line:**
* ```console
env -i $(which awk) --sandbox -v FS=' ' -v OFS=' ' --re-interval -f '/tmp/tmpamie7oua/job_working_directory/000/8/configs/tmp76atv7gm' '/tmp/tmpamie7oua/files/6/7/e/dataset_67e1a239-f171-4be2-90aa-e72dc5d5e304.dat' > '/tmp/tmpamie7oua/job_working_directory/000/8/outputs/dataset_4880640e-d2f4-4077-a381-23bfc0963a33.dat'
```
**Exit Code:**
* ```console
0
```
**Traceback:**
* ```console
```
**Job Parameters:**
* | Job parameter | Parameter value |
| ------------- | --------------- |
| \_\_input\_ext | ` "input" ` |
| \_\_workflow\_invocation\_uuid\_\_ | ` "aa1d35c0426411ef8dd33d39207549c8" ` |
| chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/hg19.len" ` |
| code | ` " ($1==\"chrM\" || $1 == \"MT\"){print $1, $3}($1!=\"chrM\" && $1!=\"MT\"){SUM+=$3}END{print \"others\", SUM} " ` |
| dbkey | ` "hg19" ` |
</details>
</details>-
Other invocation details
- **history_id** * 70bc72ebb9af8baa - **history_state** * ok - **invocation_id** * 70bc72ebb9af8baa - **invocation_state** * scheduled - **workflow_id** * 70bc72ebb9af8baa
Hello! This is an automated update of the following workflow: workflows/epigenetics/atacseq. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.
By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:
toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.8+galaxy1should be updated totoolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy0The workflow release number has been updated from 0.15 to 0.16.