search

galaxyproject / iwc

Galaxy Workflows maintained by the Intergalactic Workflow Commission
https://dockstore.org/organizations/iwc
28 stars 59 forks source link

Updating workflows/epigenetics/chipseq-sr from 0.10 to 0.11 #474

Closed gxydevbot closed 2 months ago

gxydevbot commented 2 months ago

Hello! This is an automated update of the following workflow: workflows/epigenetics/chipseq-sr. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.

By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:

The workflow release number has been updated from 0.10 to 0.11.

github-actions[bot] commented 2 months ago

Test Results (powered by Planemo)

Test Summary

Test State Count
Total 1
Passed 0
Error 0
Failure 1
Skipped 0
Failed Tests *
❌ chipseq-sr.ga_0
**Problems**: * ``` Output with path /tmp/tmpqycpni2y/cutadapt__7404fb56-f05b-4bd8-84cd-cff9ff8b9552 different than expected Expected text '4.8 50000 587 749 49251' in output ('Sample cutadapt_version r_processed r_with_adapters r_too_short r_written bp_processed quality_trimmed bp_written percent_trimmed wt_H3K4me3 4.9 50000 587 749 49251 2550000 111042 2432375 4.612745098039215 ') ``` #### Workflow invocation details * Invocation Messages *
Steps - **Step 1: SR fastq input**: * step_state: scheduled - **Step 2: adapter_forward**: * step_state: scheduled - **Step 11: Bigwig from MACS2**: * step_state: scheduled *
Jobs - **Job 1:** * Job state is ok **Command Line:** * ```console grep -v "^track" '/tmp/tmptjwnq0_0/files/b/5/9/dataset_b59701da-fef4-4eb1-b728-f9acdb5a10be.dat' | wigToBigWig stdin '/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len' '/tmp/tmptjwnq0_0/job_working_directory/000/7/outputs/dataset_3e5e6197-46b0-4fbb-87ab-b73fd4728190.dat' -clip 2>&1 || echo "Error running wigToBigWig." >&2 ``` **Exit Code:** * ```console 0 ``` **Traceback:** * ```console ``` **Job Parameters:** * | Job parameter | Parameter value | | ------------- | --------------- | | \_\_input\_ext | ` "bedgraph" ` | | \_\_workflow\_invocation\_uuid\_\_ | ` "ee57f586426411efb60339cc91df5bf6" ` | | chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len" ` | | dbkey | ` "mm10" ` | | settings | ` {"__current_case__": 0, "settingsType": "preset"} ` | 
 - **Step 12: MultiQC**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&    ln -s '/tmp/tmptjwnq0_0/files/e/8/7/dataset_e87734bc-704a-4428-b72b-6d9d65e84bdf.dat' 'multiqc_WDir/cutadapt_0/wt_H3K4me3.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/wt_H3K4me3.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/wt_H3K4me3.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" && mkdir multiqc_WDir/bowtie2_1 &&        grep -q '% overall alignment rate' /tmp/tmptjwnq0_0/files/d/9/0/dataset_d9057482-c5b4-4e91-a319-70cdfd4a3ce9.dat || die "Module 'bowtie2: '% overall alignment rate' not found in the file 'wt_H3K4me3'" && ln -s '/tmp/tmptjwnq0_0/files/d/9/0/dataset_d9057482-c5b4-4e91-a319-70cdfd4a3ce9.dat' 'multiqc_WDir/bowtie2_1/wt_H3K4me3'  &&   mkdir multiqc_WDir/macs2_2 &&    grep -q "# This file is generated by MACS" /tmp/tmptjwnq0_0/files/b/3/c/dataset_b3cc295b-1e1b-477d-ba84-4a1d2dad3c5a.dat || die "'# This file is generated by MACS' not found in the file" && ln -s '/tmp/tmptjwnq0_0/files/b/3/c/dataset_b3cc295b-1e1b-477d-ba84-4a1d2dad3c5a.dat' 'multiqc_WDir/macs2_2/wt_H3K4me3_peaks.xls' &&  multiqc multiqc_WDir --filename 'report'    --export
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console

             /// MultiQC 🔍 | v1.11

           |           multiqc | MultiQC Version v1.23 now available!
           |           multiqc | Search path : /tmp/tmptjwnq0_0/job_working_directory/000/8/working/multiqc_WDir
           |             macs2 | Found 1 logs
           |           bowtie2 | Found 1 reports
           |          cutadapt | Found 1 reports
           |           multiqc | Compressing plot data
           |           multiqc | Report      : report.html
           |           multiqc | Data        : report_data
           |           multiqc | Plots       : report_plots
           |           multiqc | MultiQC complete

           ```
        **Standard Output:**

         * ```console
           |         searching | ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 100% 4/4  
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "ee57f586426411efb60339cc91df5bf6" ` |
             | chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len" ` |
             | comment | ` "" ` |
             | dbkey | ` "mm10" ` |
             | export | ` true ` |
             | flat | ` false ` |
             | results | ` [{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}, {"__index__": 1, "software_cond": {"__current_case__": 3, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "bowtie2"}}, {"__index__": 2, "software_cond": {"__current_case__": 16, "input": {"values": [{"id": 7, "src": "hdca"}]}, "software": "macs2"}}] ` |
             | saveLog | ` false ` |
             | title | ` "" ` |

      </details>

 - **Step 3: reference_genome**:

    * step_state: scheduled

 - **Step 4: effective_genome_size**:

    * step_state: scheduled

 - **Step 5: normalize_profile**:

    * step_state: scheduled

 - **Step 6: Cutadapt (remove adapter + bad quality bases)**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -f -s '/tmp/tmptjwnq0_0/files/7/5/8/dataset_75838fb6-b6dc-46ef-85c7-2df441d6d150.dat' 'wt_H3K4me3.fq' &&  cutadapt  -j=${GALAXY_SLOTS:-4}   -a 'Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'='GATCGGAAGAGCACACGTCTGAACTCCAGTCAC'    --error-rate=0.1 --times=1 --overlap=3    --action=trim   --quality-cutoff=30       --minimum-length=15      -o 'out1.fq'  'wt_H3K4me3.fq'  > report.txt
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_job\_resource | ` {"__current_case__": 0, "__job_resource__select": "no"} ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "ee57f586426411efb60339cc91df5bf6" ` |
             | adapter\_options | ` {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"} ` |
             | chromInfo | ` "/tmp/tmptjwnq0_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filter\_options | ` {"discard_casava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "15", "minimum_length2": null, "pair_filter": "any"} ` |
             | library | ` {"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "GATCGGAAGAGCACACGTCTGAACTCCAGTCAC", "adapter_name": "Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC", "adapter_source_list": "user"}, "single_noindels": false}], "anywhere_adapters": [], "front_adapters": []}, "type": "single"} ` |
             | other\_trimming\_options | ` {"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "30", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false} ` |
             | output\_selector | ` ["report"] ` |
             | read\_mod\_options | ` {"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false} ` |

      </details>

 - **Step 7: Bowtie2 map on reference**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           set -o | grep -q pipefail && set -o pipefail;   ln -f -s '/tmp/tmptjwnq0_0/files/8/8/1/dataset_881f1a92-1bd2-4186-ac24-6781d2c426c7.dat' input_f.fastq &&   THREADS=${GALAXY_SLOTS:-4} && if [ "$THREADS" -gt 1 ]; then (( THREADS-- )); fi &&   bowtie2  -p "$THREADS"  -x '/cvmfs/data.galaxyproject.org/byhand/mm10/bowtie2_index/mm10'   -U 'input_f.fastq'                 2> >(tee '/tmp/tmptjwnq0_0/job_working_directory/000/3/outputs/dataset_d9057482-c5b4-4e91-a319-70cdfd4a3ce9.dat' >&2)  | samtools sort -l 0 -T "${TMPDIR:-.}" -O bam | samtools view --no-PG -O bam -@ ${GALAXY_SLOTS:-1} -o '/tmp/tmptjwnq0_0/job_working_directory/000/3/outputs/dataset_3dfb8bf5-a80a-4154-af10-728320355ee6.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           49251 reads; of these:
             49251 (100.00%) were unpaired; of these:
               805 (1.63%) aligned 0 times
               43525 (88.37%) aligned exactly 1 time
               4921 (9.99%) aligned >1 times
           98.37% overall alignment rate

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_job\_resource | ` {"__current_case__": 0, "__job_resource__select": "no"} ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "ee57f586426411efb60339cc91df5bf6" ` |
             | analysis\_type | ` {"__current_case__": 0, "analysis_type_selector": "simple", "presets": "no_presets"} ` |
             | chromInfo | ` "/tmp/tmptjwnq0_0/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | library | ` {"__current_case__": 0, "aligned_file": false, "input_1": {"values": [{"id": 2, "src": "dce"}]}, "type": "single", "unaligned_file": false} ` |
             | reference\_genome | ` {"__current_case__": 0, "index": "mm10", "source": "indexed"} ` |
             | rg | ` {"__current_case__": 3, "rg_selector": "do_not_set"} ` |
             | sam\_options | ` {"__current_case__": 1, "sam_options_selector": "no"} ` |
             | save\_mapping\_stats | ` true ` |

      </details>

 - **Step 8: filter MAPQ30**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmptjwnq0_0/files/3/d/f/dataset_3dfb8bf5-a80a-4154-af10-728320355ee6.dat' input.bam && ln -s '/tmp/tmptjwnq0_0/files/_metadata_files/1/4/9/metadata_149add72-521f-45cd-a3a7-38bee159d021.dat' input.bai && samtools view -o '/tmp/tmptjwnq0_0/job_working_directory/000/4/outputs/dataset_ecdf18c8-f70a-4469-95f9-86f7c7a8cefe.dat' -h   -b  -q 30 input.bam
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "bam" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "ee57f586426411efb60339cc91df5bf6" ` |
             | bed\_file | ` None ` |
             | chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len" ` |
             | dbkey | ` "mm10" ` |
             | flag | ` {"__current_case__": 0, "filter": "no"} ` |
             | header | ` "-h" ` |
             | library | ` "" ` |
             | mapq | ` "30" ` |
             | outputtype | ` "bam" ` |
             | possibly\_select\_inverse | ` false ` |
             | read\_group | ` "" ` |
             | regions | ` "" ` |

      </details>

 - **Step 9: Call Peaks with MACS2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           export PYTHON_EGG_CACHE=`pwd` &&   (macs2 callpeak   -t '/tmp/tmptjwnq0_0/files/e/c/d/dataset_ecdf18c8-f70a-4469-95f9-86f7c7a8cefe.dat'  --name wt_H3K4me3    --format BAM   --gsize '1870000000'      --SPMR     --call-summits  --keep-dup '1'  --d-min 20 --buffer-size 100000  --bdg  --qvalue '0.05'  --nomodel --extsize '200' --shift '0'  2>&1 > macs2_stderr) && cp wt_H3K4me3_peaks.xls '/tmp/tmptjwnq0_0/job_working_directory/000/5/outputs/dataset_b3cc295b-1e1b-477d-ba84-4a1d2dad3c5a.dat'   && ( count=`ls -1 wt_H3K4me3* 2>/dev/null | wc -l`; if [ $count != 0 ]; then mkdir '/tmp/tmptjwnq0_0/job_working_directory/000/5/outputs/dataset_00625164-7b94-4311-bf55-f88b2dc17a3b_files' && cp -r wt_H3K4me3* '/tmp/tmptjwnq0_0/job_working_directory/000/5/outputs/dataset_00625164-7b94-4311-bf55-f88b2dc17a3b_files' && python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/iuc/macs2/86e2413cf3f8/macs2/dir2html.py' '/tmp/tmptjwnq0_0/job_working_directory/000/5/outputs/dataset_00625164-7b94-4311-bf55-f88b2dc17a3b_files' macs2_stderr > '/tmp/tmptjwnq0_0/job_working_directory/000/5/outputs/dataset_00625164-7b94-4311-bf55-f88b2dc17a3b.dat'; fi; ) && exit_code_for_galaxy=$? && cat macs2_stderr 2>&1 && (exit $exit_code_for_galaxy)
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           INFO  @ Mon, 15 Jul 2024 04:48:24: 
           # Command line: callpeak -t /tmp/tmptjwnq0_0/files/e/c/d/dataset_ecdf18c8-f70a-4469-95f9-86f7c7a8cefe.dat --name wt_H3K4me3 --format BAM --gsize 1870000000 --SPMR --call-summits --keep-dup 1 --d-min 20 --buffer-size 100000 --bdg --qvalue 0.05 --nomodel --extsize 200 --shift 0
           # ARGUMENTS LIST:
           # name = wt_H3K4me3
           # format = BAM
           # ChIP-seq file = ['/tmp/tmptjwnq0_0/files/e/c/d/dataset_ecdf18c8-f70a-4469-95f9-86f7c7a8cefe.dat']
           # control file = None
           # effective genome size = 1.87e+09
           # band width = 300
           # model fold = [5, 50]
           # qvalue cutoff = 5.00e-02
           # The maximum gap between significant sites is assigned as the read length/tag size.
           # The minimum length of peaks is assigned as the predicted fragment length "d".
           # Larger dataset will be scaled towards smaller dataset.
           # Range for calculating regional lambda is: 10000 bps
           # Broad region calling is off
           # Paired-End mode is off
           # Searching for subpeak summits is on
           # MACS will save fragment pileup signal per million reads

           INFO  @ Mon, 15 Jul 2024 04:48:24: #1 read tag files... 
           INFO  @ Mon, 15 Jul 2024 04:48:24: #1 read treatment tags... 
           INFO  @ Mon, 15 Jul 2024 04:48:25: 44078 reads have been read. 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #1 tag size is determined as 49 bps 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #1 tag size = 49.0 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #1  total tags in treatment: 44078 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #1 user defined the maximum tags... 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #1 filter out redundant tags at the same location and the same strand by allowing at most 1 tag(s) 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #1  tags after filtering in treatment: 44038 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #1  Redundant rate of treatment: 0.00 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #1 finished! 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #2 Build Peak Model... 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #2 Skipped... 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #2 Use 200 as fragment length 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #3 Call peaks... 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #3 Going to call summits inside each peak ... 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #3 Pre-compute pvalue-qvalue table... 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #3 In the peak calling step, the following will be performed simultaneously: 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #3   Write bedGraph files for treatment pileup (after scaling if necessary)... wt_H3K4me3_treat_pileup.bdg 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #3   Write bedGraph files for control lambda (after scaling if necessary)... wt_H3K4me3_control_lambda.bdg 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #3   --SPMR is requested, so pileup will be normalized by sequencing depth in million reads. 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #3 Call peaks for each chromosome... 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #4 Write output xls file... wt_H3K4me3_peaks.xls 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #4 Write peak in narrowPeak format file... wt_H3K4me3_peaks.narrowPeak 
           INFO  @ Mon, 15 Jul 2024 04:48:25: #4 Write summits bed file... wt_H3K4me3_summits.bed 
           INFO  @ Mon, 15 Jul 2024 04:48:25: Done! 

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "ee57f586426411efb60339cc91df5bf6" ` |
             | advanced\_options | ` {"broad_options": {"__current_case__": 1, "broad_options_selector": "nobroad", "call_summits": true}, "buffer_size": "100000", "d_min": "20", "keep_dup_options": {"__current_case__": 1, "keep_dup_options_selector": "1"}, "llocal": null, "nolambda": false, "ratio": null, "slocal": null, "spmr": true, "to_large": false} ` |
             | chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len" ` |
             | control | ` {"__current_case__": 1, "c_select": "No"} ` |
             | cutoff\_options | ` {"__current_case__": 1, "cutoff_options_selector": "qvalue", "qvalue": "0.05"} ` |
             | dbkey | ` "mm10" ` |
             | effective\_genome\_size\_options | ` {"__current_case__": 4, "effective_genome_size_options_selector": "user_defined", "gsize": "1870000000"} ` |
             | format | ` "BAM" ` |
             | nomodel\_type | ` {"__current_case__": 1, "extsize": "200", "nomodel_type_selector": "nomodel", "shift": "0"} ` |
             | outputs | ` ["peaks_tabular", "summits", "bdg", "html"] ` |
             | treatment | ` {"__current_case__": 0, "input_treatment_file": {"values": [{"id": 6, "src": "dce"}]}, "t_multi_select": "No"} ` |

      </details>

 - **Step 10: summary of MACS2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           grep -P -A 0 -B 0 --no-group-separator  -i -- '^#' '/tmp/tmptjwnq0_0/files/b/3/c/dataset_b3cc295b-1e1b-477d-ba84-4a1d2dad3c5a.dat' > '/tmp/tmptjwnq0_0/job_working_directory/000/6/outputs/dataset_04983402-4bad-4246-9789-ab31fa9d5b84.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "ee57f586426411efb60339cc91df5bf6" ` |
             | case\_sensitive | ` "-i" ` |
             | chromInfo | ` "/cvmfs/data.galaxyproject.org/managed/len/ucsc/mm10.len" ` |
             | color | ` "NOCOLOR" ` |
             | dbkey | ` "mm10" ` |
             | invert | ` "" ` |
             | lines\_after | ` "0" ` |
             | lines\_before | ` "0" ` |
             | regex\_type | ` "-P" ` |
             | url\_paste | ` "^#" ` |

      </details>
  </details>
  • Other invocation details - **history_id** * dedca3ab54d4a149 - **history_state** * ok - **invocation_id** * dedca3ab54d4a149 - **invocation_state** * scheduled - **workflow_id** * dedca3ab54d4a149