search

galaxyproject / iwc

Galaxy Workflows maintained by the Intergalactic Workflow Commission
https://dockstore.org/organizations/iwc
29 stars 66 forks source link

Updating workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4 from 0.2.2 to 0.2.3 #507

Open gxydevbot opened 2 months ago

gxydevbot commented 2 months ago

Hello! This is an automated update of the following workflow: workflows/VGP-assembly-v2/Assembly-Hifi-HiC-phasing-VGP4. I created this PR because I think one or more of the component tools are out of date, i.e. there is a newer version available on the ToolShed.

By comparing with the latest versions available on the ToolShed, it seems the following tools are outdated:

The workflow release number has been updated from 0.2.2 to 0.2.3.

gxydevbot commented 2 months ago

There are new updates, if you want to integrate them, close the PR and delete branch.

gxydevbot commented 2 months ago

There are new updates, if you want to integrate them, close the PR and delete branch.

gxydevbot commented 1 month ago

There are new updates, if you want to integrate them, close the PR and delete branch.

gxydevbot commented 1 month ago

There are new updates, if you want to integrate them, close the PR and delete branch.

gxydevbot commented 1 month ago

There are new updates, if you want to integrate them, close the PR and delete branch.

gxydevbot commented 1 month ago

There are new updates, if you want to integrate them, close the PR and delete branch.

gxydevbot commented 1 month ago

There are new updates, they have been integrated to the PR, check the file diff.

github-actions[bot] commented 1 month ago

Test Results (powered by Planemo)

Test Summary

Test State Count
Total 1
Passed 0
Error 0
Failure 1
Skipped 0
Failed Tests *
❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0
**Problems**: * ``` Output with path /tmp/tmpjn4u4fe2/Busco on data 54 short summary__312473f4-6327-4c45-8721-20214655d994 different than expected Expected text 'C:1.0%[S:1.0%,D:0.0%],F:0.4%,M:98.6%,n:3354' in output ('# BUSCO version is: 5.7.1 # The lineage dataset is: vertebrata_odb10 (Creation date: 2021-02-19, number of genomes: 67, number of BUSCOs: 3354) # Summarized benchmarking in BUSCO notation for file /tmp/tmpxdrpkeq4/files/f/7/2/dataset_f7287d4e-0cc6-45d6-8d64-3a1057dae805.dat # BUSCO was run in mode: euk_genome_min # Gene predictor used: miniprot ***** Results: ***** C:1.0%[S:1.0%,D:0.0%],F:0.1%,M:98.9%,n:3354,E:6.1% 33 Complete BUSCOs (C) (of which 2 contain internal stop codons) 32 Complete and single-copy BUSCOs (S) 1 Complete and duplicated BUSCOs (D) 3 Fragmented BUSCOs (F) 3318 Missing BUSCOs (M) 3354 Total BUSCO groups searched Assembly Statistics: 72 Number of scaffolds 72 Number of contigs 1778748 Total length 0.000% Percent gaps 22 KB Scaffold N50 22 KB Contigs N50 Dependencies and versions: hmmsearch: 3.1 bbtools: None miniprot_index: 0.13-r248 miniprot_align: 0.13-r248 python: sys.version_info(major=3, minor=9, micro=19, releaselevel='final', serial=0) busco: 5.7.1 ') ``` #### Workflow invocation details * Invocation Messages *
Steps - **Step 1: Pacbio Reads Collection**: * step_state: scheduled - **Step 2: HiC forward reads**: * step_state: scheduled - **Step 11: SAK input file**: * step_state: scheduled - **Step 12: Homozygous Read Coverage**: * step_state: scheduled - **Step 13: Genomescope Model Parameters**: * step_state: scheduled - **Step 14: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1**: * step_state: scheduled *
Jobs - **Job 1:** * Job state is ok **Command Line:** * ```console ln -f -s '/tmp/tmpxdrpkeq4/files/5/7/a/dataset_57af01ec-e6aa-4e26-b756-433913551037.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' && cutadapt -j=${GALAXY_SLOTS:-4} -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT' -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT' --error-rate=0.1 --times=1 --overlap=35 --action=trim --rc --discard-trimmed --minimum-length=1 --json=stats.json -o 'out1.fq.gz' 'yeast_reads_sub1_fastq_gz.fq.gz' > report.txt ``` **Exit Code:** * ```console 0 ``` **Traceback:** * ```console ``` **Job Parameters:** * | Job parameter | Parameter value | | ------------- | --------------- | | \_\_input\_ext | ` "input" ` | | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` | | adapter\_options | ` {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"} ` | | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` | | dbkey | ` "?" ` | | filter\_options | ` {"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"} ` | | library | ` {"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"} ` | | other\_trimming\_options | ` {"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false} ` | | output\_selector | ` ["report", "json_stats"] ` | | read\_mod\_options | ` {"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false} ` | 
 - **Step 15: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_grep\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpxdrpkeq4/files/1/b/9/dataset_1b9cbc05-39c8-4fb7-a847-2613c0bedd60.dat' > '/tmp/tmpxdrpkeq4/job_working_directory/000/8/outputs/dataset_cbffd7f6-b673-4f2e-9a2a-429fff78724e.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | case\_sensitive | ` "-i" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | color | ` "NOCOLOR" ` |
             | dbkey | ` "?" ` |
             | invert | ` "" ` |
             | lines\_after | ` "0" ` |
             | lines\_before | ` "0" ` |
             | regex\_type | ` "-G" ` |
             | url\_paste | ` "Haploid" ` |

      </details>

 - **Step 16: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmpxdrpkeq4/job_working_directory/000/9/configs/tmpf4ovztcf' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpxdrpkeq4/files/5/1/f/dataset_51fa0fde-bffe-44bb-bc04-2e3b151087af.dat' '/tmp/tmpxdrpkeq4/job_working_directory/000/9/outputs/dataset_7241f8e6-41ba-4b89-bab2-c74f40184c44.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           c3*2
           Computing 1 new columns with instructions ['c3*2;;']
           Computed new column values for 100.00% of 1 lines written.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | avoid\_scientific\_notation | ` false ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
             | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"} ` |

      </details>

 - **Step 17: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpxdrpkeq4/files/f/2/6/dataset_f26b8095-66c0-4056-9866-3a3ed357f74d.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console

           /// MultiQC 🔍 v1.24.1

                version_check | MultiQC Version v1.25 now available!
                  file_search | Search path: /tmp/tmpxdrpkeq4/job_working_directory/000/10/working/multiqc_WDir

                     cutadapt | Found 1 reports

                write_results | Data        : report_data
                write_results | Report      : report.html
                      multiqc | MultiQC complete

           ```
        **Standard Output:**

         * ```console
           total 72
           -rw-r--r-- 1 1001 127    93 Sep 23 14:37 cutadapt_filtered_reads_plot.txt
           -rw-r--r-- 1 1001 127    66 Sep 23 14:37 cutadapt_trimmed_sequences_plot_default_Counts.txt
           -rw-r--r-- 1 1001 127    70 Sep 23 14:37 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
           -rw-r--r-- 1 1001 127   124 Sep 23 14:37 multiqc_citations.txt
           -rw-r--r-- 1 1001 127   222 Sep 23 14:37 multiqc_cutadapt.txt
           -rw-r--r-- 1 1001 127 39110 Sep 23 14:37 multiqc_data.json
           -rw-r--r-- 1 1001 127   105 Sep 23 14:37 multiqc_general_stats.txt
           -rw-r--r-- 1 1001 127    29 Sep 23 14:37 multiqc_software_versions.txt
           -rw-r--r-- 1 1001 127   190 Sep 23 14:37 multiqc_sources.txt

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | comment | ` "" ` |
             | dbkey | ` "?" ` |
             | export | ` false ` |
             | flat | ` false ` |
             | results | ` [{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}] ` |
             | saveLog | ` "false" ` |
             | title | ` "" ` |

      </details>

 - **Step 18: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_replace\_in\_line/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmpxdrpkeq4/files/c/b/f/dataset_cbffd7f6-b673-4f2e-9a2a-429fff78724e.dat' > '/tmp/tmpxdrpkeq4/job_working_directory/000/11/outputs/dataset_b14c2108-91a1-4daa-8da7-22436e0ef6a1.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | replacements | ` [{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}] ` |

      </details>

 - **Step 19: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmpxdrpkeq4/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpxdrpkeq4/files/7/2/4/dataset_7241f8e6-41ba-4b89-bab2-c74f40184c44.dat' 'c7' T '/tmp/tmpxdrpkeq4/job_working_directory/000/12/outputs/dataset_8c6e531b-d407-4dbc-9c76-01eff2afa1f6.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c7" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 20: Convert characters1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python /tmp/tmpxdrpkeq4/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmpxdrpkeq4/files/b/1/4/dataset_b14c2108-91a1-4daa-8da7-22436e0ef6a1.dat s /tmp/tmpxdrpkeq4/job_working_directory/000/13/outputs/dataset_f0633399-b269-4101-ad52-9c0bedde33a1.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "txt" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | condense | ` true ` |
             | convert\_from | ` "s" ` |
             | dbkey | ` "?" ` |
             | strip | ` true ` |

      </details>

 - **Step 3: HiC reverse reads**:

    * step_state: scheduled

 - **Step 21: Estimated homozygous read coverage**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 22: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmpxdrpkeq4/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpxdrpkeq4/files/f/0/6/dataset_f0633399-b269-4101-ad52-9c0bedde33a1.dat' 'c3' T '/tmp/tmpxdrpkeq4/job_working_directory/000/15/outputs/dataset_9487a55e-36e0-40c6-bce9-5ca035ea7282.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c3" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 23: Homozygous read coverage for Hifiasm**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | style\_cond | ` {"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}} ` |

      </details>

 - **Step 24: Estimated genome size**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 25: toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.9+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmpxdrpkeq4/files/3/6/7/dataset_367571ed-1f6c-4263-b8c3-0c580f642ea3.dat' input_0.fastq.gz &&  mkdir HiCF HiCR && ln -s '/tmp/tmpxdrpkeq4/files/2/6/9/dataset_26904f62-e30f-43d6-b275-9686f1f5854e.dat' ./HiCF/input_0.fastqsanger.gz &&  ln -s '/tmp/tmpxdrpkeq4/files/2/0/6/dataset_20648207-6e13-40b1-8a48-c89d51f9b222.dat' ./HiCR/input_0.fastqsanger.gz &&  hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21  --h1 './HiCF/input_0.fastqsanger.gz' --h2 './HiCR/input_0.fastqsanger.gz' --l-msjoin 500000   --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "fastq.gz" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | advanced\_options | ` {"__current_case__": 0, "advanced_selector": "blank"} ` |
             | assembly\_options | ` {"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"} ` |
             | bins\_out | ` false ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filter\_bits | ` "32" ` |
             | hic\_partition | ` {"__current_case__": 1, "f_perturb": null, "h1": {"values": [{"id": 1, "src": "hda"}]}, "h2": {"values": [{"id": 2, "src": "hda"}]}, "hic_partition_selector": "set", "l_msjoin": "500000", "n_perturb": null, "n_weight": null, "seed": null} ` |
             | log\_out | ` true ` |
             | mode | ` {"__current_case__": 0, "mode_selector": "standard", "reads": {"values": [{"id": 2, "src": "hdca"}]}} ` |
             | ont\_integration | ` {"__current_case__": 0, "ont_integration_selector": "blank"} ` |
             | purge\_options | ` {"__current_case__": 0, "purge_selector": "blank"} ` |
             | scaffolding\_options | ` {"__current_case__": 0, "scaffold_selector": "blank"} ` |

      </details>

 - **Step 26: Raw Unitig Image**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmpxdrpkeq4/files/9/f/2/dataset_9f2b4398-b689-4177-8d1e-39c128deb283.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | fontsize | ` None ` |
             | height | ` "2000" ` |
             | lengths | ` false ` |
             | names | ` false ` |
             | nodewidth | ` "25.0" ` |
             | output\_format | ` "png" ` |
             | width | ` None ` |

      </details>

 - **Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpxdrpkeq4/files/e/8/8/dataset_e88d699b-199f-4ac9-a8ae-a247b627e569.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpxdrpkeq4/job_working_directory/000/20/outputs/dataset_559fcb2b-0405-4ef7-bc47-e5815fe33541.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 28: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpxdrpkeq4/files/0/e/d/dataset_0ed164b3-a236-4869-bd77-e3a1750c8b64.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpxdrpkeq4/job_working_directory/000/21/outputs/dataset_ead259d8-4bba-46f1-9ab4-bce1a3e36fcc.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 29: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpxdrpkeq4/files/e/8/8/dataset_e88d699b-199f-4ac9-a8ae-a247b627e569.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpxdrpkeq4/job_working_directory/000/22/outputs/dataset_abc372e1-554d-4a72-8982-b5d62b3b8ab5.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 30: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpxdrpkeq4/files/e/8/8/dataset_e88d699b-199f-4ac9-a8ae-a247b627e569.dat' --discover-paths -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 4: Genomescope Summary**:

    * step_state: scheduled

 - **Step 31: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpxdrpkeq4/files/0/e/d/dataset_0ed164b3-a236-4869-bd77-e3a1750c8b64.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpxdrpkeq4/job_working_directory/000/24/outputs/dataset_e8cb3ee1-f100-4e5f-9000-314be8291da0.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpxdrpkeq4/files/0/e/d/dataset_0ed164b3-a236-4869-bd77-e3a1750c8b64.dat' --discover-paths -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpxdrpkeq4/files/e/8/8/dataset_e88d699b-199f-4ac9-a8ae-a247b627e569.dat' --discover-paths -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpxdrpkeq4/files/0/e/d/dataset_0ed164b3-a236-4869-bd77-e3a1750c8b64.dat' --discover-paths -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 35: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmpxdrpkeq4/job_working_directory/000/28/configs/tmp_0f0hprm' '/tmp/tmpxdrpkeq4/files/5/5/9/dataset_559fcb2b-0405-4ef7-bc47-e5815fe33541.dat' > '/tmp/tmpxdrpkeq4/job_working_directory/000/28/outputs/dataset_9d581db7-a501-4740-9254-1fcb2af3e0cc.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap2\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmpxdrpkeq4/job_working_directory/000/29/configs/tmp3zw83w_u' '/tmp/tmpxdrpkeq4/files/e/a/d/dataset_ead259d8-4bba-46f1-9ab4-bce1a3e36fcc.dat' > '/tmp/tmpxdrpkeq4/job_working_directory/000/29/outputs/dataset_d0397393-b6d5-4a02-ae25-0f8f6bf2ede8.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap1\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 37: Data Prep Hap2**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmpxdrpkeq4/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpxdrpkeq4/files/a/b/c/dataset_abc372e1-554d-4a72-8982-b5d62b3b8ab5.dat' --output='/tmp/tmpxdrpkeq4/job_working_directory/000/30/outputs/dataset_387dca3d-5b26-4a26-9edf-5cf6d8282565.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619379b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmpxdrpkeq4/job_working_directory/000/31/configs/tmplxlc0ini' '/tmp/tmpxdrpkeq4/files/3/8/7/dataset_387dca3d-5b26-4a26-9edf-5cf6d8282565.dat' > '/tmp/tmpxdrpkeq4/job_working_directory/000/31/outputs/dataset_136e3fc0-dcc4-4648-81b6-0f33343d86ea.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619379b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmpxdrpkeq4/files/1/3/6/dataset_136e3fc0-dcc4-4648-81b6-0f33343d86ea.dat > '/tmp/tmpxdrpkeq4/job_working_directory/000/32/outputs/dataset_1b157b5b-e1b6-48d8-8847-ab879857a319.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619379b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpxdrpkeq4/files/1/3/6/dataset_136e3fc0-dcc4-4648-81b6-0f33343d86ea.dat" "/tmp/tmpxdrpkeq4/job_working_directory/000/33/outputs/dataset_63c3ea3c-3ca0-4d6e-bbab-bdc9861f7412.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619379b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619379b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619379b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1008829", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpxdrpkeq4/job_working_directory/000/57/configs/tmp5w6zd7bt' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpxdrpkeq4/files/6/3/c/dataset_63c3ea3c-3ca0-4d6e-bbab-bdc9861f7412.dat' '/tmp/tmpxdrpkeq4/job_working_directory/000/57/outputs/dataset_95d1b185-4c17-4f59-827d-0c6383dc4e59.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1008829
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1008829;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 35 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619379b911ef961fedae34042c46" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1008829"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 38: Data Prep Hap1**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmpxdrpkeq4/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpxdrpkeq4/files/e/8/c/dataset_e8cb3ee1-f100-4e5f-9000-314be8291da0.dat' --output='/tmp/tmpxdrpkeq4/job_working_directory/000/35/outputs/dataset_381d2c84-1244-42d2-846a-15f77d90a91c.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619479b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmpxdrpkeq4/job_working_directory/000/36/configs/tmpplhbszfl' '/tmp/tmpxdrpkeq4/files/3/8/1/dataset_381d2c84-1244-42d2-846a-15f77d90a91c.dat' > '/tmp/tmpxdrpkeq4/job_working_directory/000/36/outputs/dataset_b965e74b-0b49-4322-b607-08bb249c4aeb.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619479b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmpxdrpkeq4/files/b/9/6/dataset_b965e74b-0b49-4322-b607-08bb249c4aeb.dat > '/tmp/tmpxdrpkeq4/job_working_directory/000/37/outputs/dataset_fad080f6-2c1b-4b18-b3fc-292da6c3ee76.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619479b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpxdrpkeq4/files/b/9/6/dataset_b965e74b-0b49-4322-b607-08bb249c4aeb.dat" "/tmp/tmpxdrpkeq4/job_working_directory/000/38/outputs/dataset_8e4299ec-8c73-4187-9793-6cd20781d4ec.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619479b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619479b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619479b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1778748", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpxdrpkeq4/job_working_directory/000/56/configs/tmpv4tia3sx' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpxdrpkeq4/files/8/e/4/dataset_8e4299ec-8c73-4187-9793-6cd20781d4ec.dat' '/tmp/tmpxdrpkeq4/job_working_directory/000/56/outputs/dataset_228a378c-1421-4d38-8f73-b37806192866.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1778748
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1778748;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 72 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619479b911ef961fedae34042c46" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1778748"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 39: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmpxdrpkeq4/job_working_directory/000/40/configs/tmpbqzfokze' '/tmp/tmpxdrpkeq4/files/0/8/9/dataset_08917760-bba8-4197-a466-8f0159feba84.dat' > '/tmp/tmpxdrpkeq4/job_working_directory/000/40/outputs/dataset_2e89a87f-8031-4151-9b2e-0bbfe4834910.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 40: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmpxdrpkeq4/job_working_directory/000/41/configs/tmpi773qoyb' '/tmp/tmpxdrpkeq4/files/1/b/2/dataset_1b267fdf-f17a-47a2-a903-87d124f91079.dat' > '/tmp/tmpxdrpkeq4/job_working_directory/000/41/outputs/dataset_f7287d4e-0cc6-45d6-8d64-3a1057dae805.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 5: Meryl Database**:

    * step_state: scheduled

 - **Step 41: join1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/tmpxdrpkeq4/galaxy-dev/tools/filters/join.py' '/tmp/tmpxdrpkeq4/files/d/0/3/dataset_d0397393-b6d5-4a02-ae25-0f8f6bf2ede8.dat' '/tmp/tmpxdrpkeq4/files/9/d/5/dataset_9d581db7-a501-4740-9254-1fcb2af3e0cc.dat' 1 1 '/tmp/tmpxdrpkeq4/job_working_directory/000/42/outputs/dataset_96ff1a44-47d1-4ece-922c-8e6e0ebe2a84.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmpxdrpkeq4/job_working_directory/000/42/configs/tmpsaikuz3p
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | field1 | ` "1" ` |
             | field2 | ` "1" ` |
             | fill\_empty\_columns | ` {"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"} ` |
             | header | ` "" ` |
             | partial | ` "-p" ` |
             | unmatched | ` "-u" ` |

      </details>

 - **Step 42: Plot Data**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: Primary data**:

         * step_state: scheduled

      - **Step 2: Alternate data**:

         * step_state: scheduled

      - **Step 11: Size Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpxdrpkeq4/job_working_directory/000/64/configs/tmp7uo8c9tz' && Rscript '/tmp/tmpxdrpkeq4/job_working_directory/000/64/configs/tmp7uo8c9tz'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmpxdrpkeq4/files/f/6/7/dataset_f67f43da-e40c-4c65-bf5c-093948519f04.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmpxdrpkeq4/job_working_directory/000/64/outputs/dataset_245c6e44-cd4f-4686-8fbe-6c3769ab31ea.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619579b911ef961fedae34042c46" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "Scaffold number" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Cumulative Size (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>

      - **Step 3: Name of primary assembly**:

         * step_state: scheduled

      - **Step 4: Name of alternate assembly**:

         * step_state: scheduled

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpxdrpkeq4/files/2/2/8/dataset_228a378c-1421-4d38-8f73-b37806192866.dat" "/tmp/tmpxdrpkeq4/job_working_directory/000/58/outputs/dataset_1188d368-f435-4a54-941b-9409bdcf0bed.dat" "Hap1" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console

                  File "/opt/hostedtoolcache/Python/3.11.10/x64/lib/python3.11/threading.py", line 959, in start

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619579b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap1" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpxdrpkeq4/files/9/5/d/dataset_95d1b185-4c17-4f59-827d-0c6383dc4e59.dat" "/tmp/tmpxdrpkeq4/job_working_directory/000/59/outputs/dataset_c92d19c6-bcc5-4f53-9537-6c6000b2c4d9.dat" "Hap2" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619579b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap2" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cat/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpxdrpkeq4/files/1/1/8/dataset_1188d368-f435-4a54-941b-9409bdcf0bed.dat' >> '/tmp/tmpxdrpkeq4/job_working_directory/000/60/outputs/dataset_b396b40e-4be8-4583-866d-24adbae478c1.dat' && cat '/tmp/tmpxdrpkeq4/files/c/9/2/dataset_c92d19c6-bcc5-4f53-9537-6c6000b2c4d9.dat' >> '/tmp/tmpxdrpkeq4/job_working_directory/000/60/outputs/dataset_b396b40e-4be8-4583-866d-24adbae478c1.dat' && exit 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619579b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | queries | ` [{"__index__": 0, "inputs2": {"values": [{"id": 105, "src": "hda"}]}}] ` |

           </details>

      - **Step 8: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmpxdrpkeq4/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpxdrpkeq4/files/b/3/9/dataset_b396b40e-4be8-4583-866d-24adbae478c1.dat' 'c8,c5,c6' T '/tmp/tmpxdrpkeq4/job_working_directory/000/61/outputs/dataset_5d121a6d-8b0d-4c3e-aeac-20e70776849e.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619579b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c5,c6" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 9: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmpxdrpkeq4/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpxdrpkeq4/files/b/3/9/dataset_b396b40e-4be8-4583-866d-24adbae478c1.dat' 'c8,c4,c7' T '/tmp/tmpxdrpkeq4/job_working_directory/000/62/outputs/dataset_f67f43da-e40c-4c65-bf5c-093948519f04.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619579b911ef961fedae34042c46" ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c4,c7" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 10: Nx Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpxdrpkeq4/job_working_directory/000/63/configs/tmpa0s364ol' && Rscript '/tmp/tmpxdrpkeq4/job_working_directory/000/63/configs/tmpa0s364ol'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmpxdrpkeq4/files/5/d/1/dataset_5d121a6d-8b0d-4c3e-aeac-20e70776849e.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmpxdrpkeq4/job_working_directory/000/63/outputs/dataset_df2d9966-2dcc-4be2-aafa-210e58dab56e.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619579b911ef961fedae34042c46" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "x" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Nx (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>
       </details>

 - **Step 43: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmpxdrpkeq4/files/2/e/8/dataset_2e89a87f-8031-4151-9b2e-0bbfe4834910.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-09-23 14:55:38 ERROR:   Something went wrong. Results not recorded.
           2024-09-23 14:55:38 ERROR:   BUSCO analysis failed!
           2024-09-23 14:55:38 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-09-23 14:44:16 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 09/23/2024 14:44:16 *****
           2024-09-23 14:44:16 INFO:    Configuring BUSCO with local environment
           2024-09-23 14:44:16 INFO:    Running genome mode
           2024-09-23 14:44:19 INFO:    Input file is /tmp/tmpxdrpkeq4/files/2/e/8/dataset_2e89a87f-8031-4151-9b2e-0bbfe4834910.dat
           2024-09-23 14:44:19 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-09-23 14:44:19 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-09-23 14:44:19 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-09-23 14:44:19 INFO:    Running 1 job(s) on bbtools, starting at 09/23/2024 14:44:19
           2024-09-23 14:44:21 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-09-23 14:44:21 INFO:    Running 1 job(s) on miniprot_index, starting at 09/23/2024 14:44:21
           2024-09-23 14:44:22 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-09-23 14:44:22 INFO:    Running 1 job(s) on miniprot_align, starting at 09/23/2024 14:44:22
           2024-09-23 14:54:46 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-09-23 14:54:49 INFO:    ***** Run HMMER on gene sequences *****
           2024-09-23 14:54:56 INFO:    Running 395 job(s) on hmmsearch, starting at 09/23/2024 14:54:56
           2024-09-23 14:55:11 INFO:    [hmmsearch] 40 of 395 task(s) completed
           2024-09-23 14:55:14 INFO:    [hmmsearch] 79 of 395 task(s) completed
           2024-09-23 14:55:17 INFO:    [hmmsearch] 119 of 395 task(s) completed
           2024-09-23 14:55:20 INFO:    [hmmsearch] 158 of 395 task(s) completed
           2024-09-23 14:55:23 INFO:    [hmmsearch] 198 of 395 task(s) completed
           2024-09-23 14:55:26 INFO:    [hmmsearch] 237 of 395 task(s) completed
           2024-09-23 14:55:29 INFO:    [hmmsearch] 277 of 395 task(s) completed
           2024-09-23 14:55:31 INFO:    [hmmsearch] 316 of 395 task(s) completed
           2024-09-23 14:55:35 INFO:    [hmmsearch] 356 of 395 task(s) completed
           2024-09-23 14:55:38 INFO:    [hmmsearch] 395 of 395 task(s) completed
           2024-09-23 14:55:38 INFO:    21 exons in total
           2024-09-23 14:55:38 WARNING: 1 of 16 Complete matches (6.2%) contain internal stop codons in Miniprot gene predictions

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 44: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy4**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           mkdir -p output_files && mkdir -p read-db.meryl && tar -zxf /tmp/tmpxdrpkeq4/files/c/7/5/dataset_c750ed45-ff2b-40a1-ba0c-1c5bddb448b8.dat -C read-db.meryl --strip-components=1 && ln -s '/tmp/tmpxdrpkeq4/files/f/7/2/dataset_f7287d4e-0cc6-45d6-8d64-3a1057dae805.dat' assembly_01.fasta && ln -s '/tmp/tmpxdrpkeq4/files/2/e/8/dataset_2e89a87f-8031-4151-9b2e-0bbfe4834910.dat' assembly_02.fasta && merqury.sh read-db.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmpxdrpkeq4/job_working_directory/000/44/outputs/dataset_f5209e04-f69d-46c6-9aec-323a15c3119a.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | label | ` "output_merqury" ` |
             | mode | ` {"__current_case__": 0, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 49, "src": "hda"}]}, "assembly_02": {"values": [{"id": 48, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 5, "src": "hda"}]}, "options": "default"} ` |
             | output\_add\_headers | ` true ` |
             | output\_selector | ` ["qv", "plots", "stats", "log", "hist"] ` |

      </details>

 - **Step 45: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmpxdrpkeq4/files/f/7/2/dataset_f7287d4e-0cc6-45d6-8d64-3a1057dae805.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-09-23 15:01:34 ERROR:   Something went wrong. Results not recorded.
           2024-09-23 15:01:34 ERROR:   BUSCO analysis failed!
           2024-09-23 15:01:34 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-09-23 14:44:16 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 09/23/2024 14:44:16 *****
           2024-09-23 14:44:16 INFO:    Configuring BUSCO with local environment
           2024-09-23 14:44:16 INFO:    Running genome mode
           2024-09-23 14:44:19 INFO:    Input file is /tmp/tmpxdrpkeq4/files/f/7/2/dataset_f7287d4e-0cc6-45d6-8d64-3a1057dae805.dat
           2024-09-23 14:44:19 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-09-23 14:44:19 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-09-23 14:44:19 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-09-23 14:44:19 INFO:    Running 1 job(s) on bbtools, starting at 09/23/2024 14:44:19
           2024-09-23 14:44:21 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-09-23 14:44:21 INFO:    Running 1 job(s) on miniprot_index, starting at 09/23/2024 14:44:21
           2024-09-23 14:44:22 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-09-23 14:44:22 INFO:    Running 1 job(s) on miniprot_align, starting at 09/23/2024 14:44:22
           2024-09-23 15:00:49 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-09-23 15:00:54 INFO:    ***** Run HMMER on gene sequences *****
           2024-09-23 15:00:55 INFO:    Running 584 job(s) on hmmsearch, starting at 09/23/2024 15:00:55
           2024-09-23 15:00:59 INFO:    [hmmsearch] 59 of 584 task(s) completed
           2024-09-23 15:01:17 INFO:    [hmmsearch] 117 of 584 task(s) completed
           2024-09-23 15:01:20 INFO:    [hmmsearch] 176 of 584 task(s) completed
           2024-09-23 15:01:21 INFO:    [hmmsearch] 234 of 584 task(s) completed
           2024-09-23 15:01:23 INFO:    [hmmsearch] 292 of 584 task(s) completed
           2024-09-23 15:01:26 INFO:    [hmmsearch] 351 of 584 task(s) completed
           2024-09-23 15:01:28 INFO:    [hmmsearch] 409 of 584 task(s) completed
           2024-09-23 15:01:29 INFO:    [hmmsearch] 468 of 584 task(s) completed
           2024-09-23 15:01:31 INFO:    [hmmsearch] 526 of 584 task(s) completed
           2024-09-23 15:01:33 INFO:    [hmmsearch] 584 of 584 task(s) completed
           2024-09-23 15:01:34 INFO:    42 exons in total
           2024-09-23 15:01:34 WARNING: 2 of 33 Complete matches (6.1%) contain internal stop codons in Miniprot gene predictions
           2024-09-23 15:01:34 WARNING: BUSCO gene predictions from Miniprot have low average identity (0.4399999976158142). You may want to repeat the analysis using the Metaeuk pipeline.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 46: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cut\_tool/9.3+galaxy2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cut --complement -f '3' '/tmp/tmpxdrpkeq4/files/9/6/f/dataset_96ff1a44-47d1-4ece-922c-8e6e0ebe2a84.dat' > '/tmp/tmpxdrpkeq4/job_working_directory/000/46/outputs/dataset_d18db83e-48d2-42bd-b0fb-618ef85aa620.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | complement | ` "--complement" ` |
             | cut\_type\_options | ` {"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""} ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 47: output_merqury.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 48: output_merqury.spectra-asm.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 49: merqury_qv**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | input | ` {"values": [{"id": 6, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 50: output_merqury.assembly_01.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 6: Database for Busco Lineage**:

    * step_state: scheduled

 - **Step 51: merqury_stats**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | input | ` {"values": [{"id": 8, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 52: output_merqury.assembly_02.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 53: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_find\_and\_replace/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmpxdrpkeq4/job_working_directory/000/47/outputs/dataset_21b8196a-9804-4a4e-9d24-41014b33db6e.dat' -g     '#' 'Number of' '/tmp/tmpxdrpkeq4/files/d/1/8/dataset_d18db83e-48d2-42bd-b0fb-618ef85aa620.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "3df0619279b911ef961fedae34042c46" ` |
             | chromInfo | ` "/tmp/tmpxdrpkeq4/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | find\_and\_replace | ` [{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}] ` |

      </details>

 - **Step 7: Lineage**:

    * step_state: scheduled

 - **Step 8: Name for Haplotype 1**:

    * step_state: scheduled

 - **Step 9: Name for Haplotype 2**:

    * step_state: scheduled

 - **Step 10: Bits for bloom filter**:

    * step_state: scheduled

  </details>
  • Other invocation details - **history_id** * 47b53bd1b326d49f - **history_state** * ok - **invocation_id** * 47b53bd1b326d49f - **invocation_state** * scheduled - **workflow_id** * c6a96b24674c1eb8

lldelisle commented 1 month ago

If someone works on this PR, please integrate https://github.com/galaxyproject/iwc/pull/530/files#diff-0c4b01d2c6965038c29b85a701d690020bb97c1566763c0dd8edabbc71f13c94

gxydevbot commented 1 month ago

There are new updates, they have been integrated to the PR, check the file diff.

github-actions[bot] commented 1 month ago

Test Results (powered by Planemo)

Test Summary

Test State Count
Total 1
Passed 0
Error 0
Failure 1
Skipped 0
Failed Tests *
❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0
**Problems**: * ``` Output with path /tmp/tmpy73hhxoq/Busco on data 54 short summary__0148efd4-b385-4c4b-af83-5cc1e3186a4f different than expected Expected text 'C:1.0%[S:1.0%,D:0.0%],F:0.4%,M:98.6%,n:3354' in output ('# BUSCO version is: 5.7.1 # The lineage dataset is: vertebrata_odb10 (Creation date: 2021-02-19, number of genomes: 67, number of BUSCOs: 3354) # Summarized benchmarking in BUSCO notation for file /tmp/tmp6tyncd2s/files/4/4/7/dataset_4473ea14-b23c-40e9-b824-2d976c477d20.dat # BUSCO was run in mode: euk_genome_min # Gene predictor used: miniprot ***** Results: ***** C:1.0%[S:1.0%,D:0.0%],F:0.1%,M:98.9%,n:3354,E:6.1% 33 Complete BUSCOs (C) (of which 2 contain internal stop codons) 32 Complete and single-copy BUSCOs (S) 1 Complete and duplicated BUSCOs (D) 3 Fragmented BUSCOs (F) 3318 Missing BUSCOs (M) 3354 Total BUSCO groups searched Assembly Statistics: 72 Number of scaffolds 72 Number of contigs 1778748 Total length 0.000% Percent gaps 22 KB Scaffold N50 22 KB Contigs N50 Dependencies and versions: hmmsearch: 3.1 bbtools: None miniprot_index: 0.13-r248 miniprot_align: 0.13-r248 python: sys.version_info(major=3, minor=9, micro=19, releaselevel='final', serial=0) busco: 5.7.1 ') ``` #### Workflow invocation details * Invocation Messages *
Steps - **Step 1: Pacbio Reads Collection**: * step_state: scheduled - **Step 2: HiC forward reads**: * step_state: scheduled - **Step 11: SAK input file**: * step_state: scheduled - **Step 12: Homozygous Read Coverage**: * step_state: scheduled - **Step 13: Genomescope Model Parameters**: * step_state: scheduled - **Step 14: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1**: * step_state: scheduled *
Jobs - **Job 1:** * Job state is ok **Command Line:** * ```console ln -f -s '/tmp/tmp6tyncd2s/files/0/d/0/dataset_0d0a8375-f15e-4322-bc5f-d099c9d54d18.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' && cutadapt -j=${GALAXY_SLOTS:-4} -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT' -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT' --error-rate=0.1 --times=1 --overlap=35 --action=trim --rc --discard-trimmed --minimum-length=1 --json=stats.json -o 'out1.fq.gz' 'yeast_reads_sub1_fastq_gz.fq.gz' > report.txt ``` **Exit Code:** * ```console 0 ``` **Traceback:** * ```console ``` **Job Parameters:** * | Job parameter | Parameter value | | ------------- | --------------- | | \_\_input\_ext | ` "input" ` | | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` | | adapter\_options | ` {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"} ` | | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` | | dbkey | ` "?" ` | | filter\_options | ` {"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"} ` | | library | ` {"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"} ` | | other\_trimming\_options | ` {"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false} ` | | output\_selector | ` ["report", "json_stats"] ` | | read\_mod\_options | ` {"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false} ` | 
 - **Step 15: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_grep\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmp6tyncd2s/files/b/5/3/dataset_b533f246-cfea-407f-9bec-199092b6c4bb.dat' > '/tmp/tmp6tyncd2s/job_working_directory/000/8/outputs/dataset_9f63c5ba-cace-47cb-9306-5a0a87b62185.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | case\_sensitive | ` "-i" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | color | ` "NOCOLOR" ` |
             | dbkey | ` "?" ` |
             | invert | ` "" ` |
             | lines\_after | ` "0" ` |
             | lines\_before | ` "0" ` |
             | regex\_type | ` "-G" ` |
             | url\_paste | ` "Haploid" ` |

      </details>

 - **Step 16: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmp6tyncd2s/job_working_directory/000/9/configs/tmpt0mg5rj1' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmp6tyncd2s/files/8/9/4/dataset_8942e6ed-a204-452a-818b-1115c5d62a2d.dat' '/tmp/tmp6tyncd2s/job_working_directory/000/9/outputs/dataset_29eff685-6120-48a7-8f69-c1ac14bbe253.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           c3*2
           Computing 1 new columns with instructions ['c3*2;;']
           Computed new column values for 100.00% of 1 lines written.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | avoid\_scientific\_notation | ` false ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
             | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"} ` |

      </details>

 - **Step 17: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmp6tyncd2s/files/3/a/9/dataset_3a9db06c-92ce-4536-93e6-4964217b4e36.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console

           /// MultiQC 🔍 v1.24.1

                version_check | MultiQC Version v1.25 now available!
                  file_search | Search path: /tmp/tmp6tyncd2s/job_working_directory/000/10/working/multiqc_WDir

                     cutadapt | Found 1 reports

                write_results | Data        : report_data
                write_results | Report      : report.html
                      multiqc | MultiQC complete

           ```
        **Standard Output:**

         * ```console
           total 72
           -rw-r--r-- 1 1001 127    93 Sep 24 13:40 cutadapt_filtered_reads_plot.txt
           -rw-r--r-- 1 1001 127    66 Sep 24 13:40 cutadapt_trimmed_sequences_plot_default_Counts.txt
           -rw-r--r-- 1 1001 127    70 Sep 24 13:40 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
           -rw-r--r-- 1 1001 127   124 Sep 24 13:40 multiqc_citations.txt
           -rw-r--r-- 1 1001 127   222 Sep 24 13:40 multiqc_cutadapt.txt
           -rw-r--r-- 1 1001 127 39110 Sep 24 13:40 multiqc_data.json
           -rw-r--r-- 1 1001 127   105 Sep 24 13:40 multiqc_general_stats.txt
           -rw-r--r-- 1 1001 127    29 Sep 24 13:40 multiqc_software_versions.txt
           -rw-r--r-- 1 1001 127   190 Sep 24 13:40 multiqc_sources.txt

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | comment | ` "" ` |
             | dbkey | ` "?" ` |
             | export | ` false ` |
             | flat | ` false ` |
             | results | ` [{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}] ` |
             | saveLog | ` "false" ` |
             | title | ` "" ` |

      </details>

 - **Step 18: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_replace\_in\_line/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmp6tyncd2s/files/9/f/6/dataset_9f63c5ba-cace-47cb-9306-5a0a87b62185.dat' > '/tmp/tmp6tyncd2s/job_working_directory/000/11/outputs/dataset_50b48ac3-59be-40bf-a04f-9e44569eaa0a.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | replacements | ` [{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}] ` |

      </details>

 - **Step 19: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmp6tyncd2s/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmp6tyncd2s/files/2/9/e/dataset_29eff685-6120-48a7-8f69-c1ac14bbe253.dat' 'c7' T '/tmp/tmp6tyncd2s/job_working_directory/000/12/outputs/dataset_eb745f56-8692-4677-8d2f-9257284d2453.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c7" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 20: Convert characters1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python /tmp/tmp6tyncd2s/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmp6tyncd2s/files/5/0/b/dataset_50b48ac3-59be-40bf-a04f-9e44569eaa0a.dat s /tmp/tmp6tyncd2s/job_working_directory/000/13/outputs/dataset_65cc4702-cd3c-4c9f-b5a7-d0b3249a227a.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "txt" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | condense | ` true ` |
             | convert\_from | ` "s" ` |
             | dbkey | ` "?" ` |
             | strip | ` true ` |

      </details>

 - **Step 3: HiC reverse reads**:

    * step_state: scheduled

 - **Step 21: Estimated homozygous read coverage**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 22: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmp6tyncd2s/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmp6tyncd2s/files/6/5/c/dataset_65cc4702-cd3c-4c9f-b5a7-d0b3249a227a.dat' 'c3' T '/tmp/tmp6tyncd2s/job_working_directory/000/15/outputs/dataset_5b882660-497f-42ad-ab26-27809d4f015f.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c3" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 23: Homozygous read coverage for Hifiasm**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | style\_cond | ` {"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}} ` |

      </details>

 - **Step 24: Estimated genome size**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 25: toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.9+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmp6tyncd2s/files/a/2/5/dataset_a25e3aac-f186-4313-bca7-59b2ff1f6600.dat' input_0.fastq.gz &&  mkdir HiCF HiCR && ln -s '/tmp/tmp6tyncd2s/files/e/e/1/dataset_ee1bf2e7-9d28-4652-863f-8026df2ad898.dat' ./HiCF/input_0.fastqsanger.gz &&  ln -s '/tmp/tmp6tyncd2s/files/0/7/b/dataset_07b6eb1b-4327-4141-b2ce-e7093c36039b.dat' ./HiCR/input_0.fastqsanger.gz &&  hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21  --h1 './HiCF/input_0.fastqsanger.gz' --h2 './HiCR/input_0.fastqsanger.gz' --l-msjoin 500000   --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "fastq.gz" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | advanced\_options | ` {"__current_case__": 0, "advanced_selector": "blank"} ` |
             | assembly\_options | ` {"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"} ` |
             | bins\_out | ` false ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filter\_bits | ` "32" ` |
             | hic\_partition | ` {"__current_case__": 1, "f_perturb": null, "h1": {"values": [{"id": 1, "src": "hda"}]}, "h2": {"values": [{"id": 2, "src": "hda"}]}, "hic_partition_selector": "set", "l_msjoin": "500000", "n_perturb": null, "n_weight": null, "seed": null} ` |
             | log\_out | ` true ` |
             | mode | ` {"__current_case__": 0, "mode_selector": "standard", "reads": {"values": [{"id": 2, "src": "hdca"}]}} ` |
             | ont\_integration | ` {"__current_case__": 0, "ont_integration_selector": "blank"} ` |
             | purge\_options | ` {"__current_case__": 0, "purge_selector": "blank"} ` |
             | scaffolding\_options | ` {"__current_case__": 0, "scaffold_selector": "blank"} ` |

      </details>

 - **Step 26: Raw Unitig Image**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmp6tyncd2s/files/5/4/b/dataset_54b68c44-c407-4387-9d36-957fdfb75e59.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | fontsize | ` None ` |
             | height | ` "2000" ` |
             | lengths | ` false ` |
             | names | ` false ` |
             | nodewidth | ` "25.0" ` |
             | output\_format | ` "png" ` |
             | width | ` None ` |

      </details>

 - **Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmp6tyncd2s/files/2/8/9/dataset_289ebddc-fecb-4a13-b983-d47de9187c2d.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmp6tyncd2s/job_working_directory/000/20/outputs/dataset_cc885c5e-9512-469d-8193-daff673ee3f7.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 28: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmp6tyncd2s/files/5/c/5/dataset_5c5e8594-e147-4f43-a2e0-23322e58fa96.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmp6tyncd2s/job_working_directory/000/21/outputs/dataset_5212d7b0-cff4-4c24-aa38-ecdea604c167.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 29: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmp6tyncd2s/files/2/8/9/dataset_289ebddc-fecb-4a13-b983-d47de9187c2d.dat' --out-size c  --discover-paths --tabular > '/tmp/tmp6tyncd2s/job_working_directory/000/22/outputs/dataset_458f6360-0bb0-4523-84f9-d68a1075f064.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 30: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmp6tyncd2s/files/2/8/9/dataset_289ebddc-fecb-4a13-b983-d47de9187c2d.dat' --discover-paths -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 4: Genomescope Summary**:

    * step_state: scheduled

 - **Step 31: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmp6tyncd2s/files/5/c/5/dataset_5c5e8594-e147-4f43-a2e0-23322e58fa96.dat' --out-size c  --discover-paths --tabular > '/tmp/tmp6tyncd2s/job_working_directory/000/24/outputs/dataset_7a0f3152-93aa-42bc-aa00-7f51f2da3b58.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmp6tyncd2s/files/5/c/5/dataset_5c5e8594-e147-4f43-a2e0-23322e58fa96.dat' --discover-paths -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmp6tyncd2s/files/2/8/9/dataset_289ebddc-fecb-4a13-b983-d47de9187c2d.dat' --discover-paths -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.6+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmp6tyncd2s/files/5/c/5/dataset_5c5e8594-e147-4f43-a2e0-23322e58fa96.dat' --discover-paths -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 35: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmp6tyncd2s/job_working_directory/000/28/configs/tmpkzmpoun7' '/tmp/tmp6tyncd2s/files/c/c/8/dataset_cc885c5e-9512-469d-8193-daff673ee3f7.dat' > '/tmp/tmp6tyncd2s/job_working_directory/000/28/outputs/dataset_b4796c2e-f0ea-4942-8e44-ddc09d228219.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap2\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmp6tyncd2s/job_working_directory/000/29/configs/tmp75bixrzs' '/tmp/tmp6tyncd2s/files/5/2/1/dataset_5212d7b0-cff4-4c24-aa38-ecdea604c167.dat' > '/tmp/tmp6tyncd2s/job_working_directory/000/29/outputs/dataset_e06168f3-b1df-4775-9c81-ffa125380e93.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap1\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 37: Data Prep Hap2**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmp6tyncd2s/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmp6tyncd2s/files/4/5/8/dataset_458f6360-0bb0-4523-84f9-d68a1075f064.dat' --output='/tmp/tmp6tyncd2s/job_working_directory/000/30/outputs/dataset_3fb1623d-fa73-4243-8cf3-d961f8549f6c.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3af7a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmp6tyncd2s/job_working_directory/000/31/configs/tmpqe665ga6' '/tmp/tmp6tyncd2s/files/3/f/b/dataset_3fb1623d-fa73-4243-8cf3-d961f8549f6c.dat' > '/tmp/tmp6tyncd2s/job_working_directory/000/31/outputs/dataset_8f38f9aa-d38c-465d-9404-963f561fe6f8.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3af7a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmp6tyncd2s/files/8/f/3/dataset_8f38f9aa-d38c-465d-9404-963f561fe6f8.dat > '/tmp/tmp6tyncd2s/job_working_directory/000/32/outputs/dataset_33f029a3-054f-4f82-80c8-2d9c3c40034a.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3af7a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmp6tyncd2s/files/8/f/3/dataset_8f38f9aa-d38c-465d-9404-963f561fe6f8.dat" "/tmp/tmp6tyncd2s/job_working_directory/000/33/outputs/dataset_6c7cbe33-b709-4251-b4e9-79ffbd734505.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3af7a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3af7a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3af7a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1008829", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmp6tyncd2s/job_working_directory/000/56/configs/tmpwsi3qy59' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmp6tyncd2s/files/6/c/7/dataset_6c7cbe33-b709-4251-b4e9-79ffbd734505.dat' '/tmp/tmp6tyncd2s/job_working_directory/000/56/outputs/dataset_0b930632-a736-41d7-b8fe-d1188628498e.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1008829
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1008829;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 35 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3af7a7a11ef842069e4c1442b15" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1008829"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 38: Data Prep Hap1**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmp6tyncd2s/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmp6tyncd2s/files/7/a/0/dataset_7a0f3152-93aa-42bc-aa00-7f51f2da3b58.dat' --output='/tmp/tmp6tyncd2s/job_working_directory/000/35/outputs/dataset_97bd4f7e-4758-4b86-bd96-8d8aef0f2955.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3b07a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmp6tyncd2s/job_working_directory/000/36/configs/tmp3l___f_f' '/tmp/tmp6tyncd2s/files/9/7/b/dataset_97bd4f7e-4758-4b86-bd96-8d8aef0f2955.dat' > '/tmp/tmp6tyncd2s/job_working_directory/000/36/outputs/dataset_a91a9a23-c009-4280-b72a-1f571b218452.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3b07a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmp6tyncd2s/files/a/9/1/dataset_a91a9a23-c009-4280-b72a-1f571b218452.dat > '/tmp/tmp6tyncd2s/job_working_directory/000/37/outputs/dataset_1e7e1612-b46e-4034-9efb-a8ac855c7c65.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3b07a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmp6tyncd2s/files/a/9/1/dataset_a91a9a23-c009-4280-b72a-1f571b218452.dat" "/tmp/tmp6tyncd2s/job_working_directory/000/38/outputs/dataset_1c575b95-7b89-4a48-a682-3ad7ec7627d4.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3b07a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3b07a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3b07a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1778748", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmp6tyncd2s/job_working_directory/000/57/configs/tmpg9tbu_f7' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmp6tyncd2s/files/1/c/5/dataset_1c575b95-7b89-4a48-a682-3ad7ec7627d4.dat' '/tmp/tmp6tyncd2s/job_working_directory/000/57/outputs/dataset_6cc2f442-9a1b-4a99-9e47-6d8cca45cc55.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1778748
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1778748;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 72 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3b07a7a11ef842069e4c1442b15" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1778748"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 39: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmp6tyncd2s/job_working_directory/000/40/configs/tmpavleeesm' '/tmp/tmp6tyncd2s/files/c/0/f/dataset_c0f703d4-d7f4-4469-9bee-04cba73c9908.dat' > '/tmp/tmp6tyncd2s/job_working_directory/000/40/outputs/dataset_ac28c65f-5835-40e7-9a6a-a13879979a12.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 40: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmp6tyncd2s/job_working_directory/000/41/configs/tmpcnny7qmt' '/tmp/tmp6tyncd2s/files/2/d/7/dataset_2d767592-b3c8-4d7b-820a-29ffc213a538.dat' > '/tmp/tmp6tyncd2s/job_working_directory/000/41/outputs/dataset_4473ea14-b23c-40e9-b824-2d976c477d20.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 5: Meryl Database**:

    * step_state: scheduled

 - **Step 41: join1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/tmp6tyncd2s/galaxy-dev/tools/filters/join.py' '/tmp/tmp6tyncd2s/files/e/0/6/dataset_e06168f3-b1df-4775-9c81-ffa125380e93.dat' '/tmp/tmp6tyncd2s/files/b/4/7/dataset_b4796c2e-f0ea-4942-8e44-ddc09d228219.dat' 1 1 '/tmp/tmp6tyncd2s/job_working_directory/000/42/outputs/dataset_c96980fa-0dcb-4030-94cb-03a7560069f8.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmp6tyncd2s/job_working_directory/000/42/configs/tmpy3_xwq5r
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | field1 | ` "1" ` |
             | field2 | ` "1" ` |
             | fill\_empty\_columns | ` {"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"} ` |
             | header | ` "" ` |
             | partial | ` "-p" ` |
             | unmatched | ` "-u" ` |

      </details>

 - **Step 42: Plot Data**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: Primary data**:

         * step_state: scheduled

      - **Step 2: Alternate data**:

         * step_state: scheduled

      - **Step 11: Size Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmp6tyncd2s/job_working_directory/000/64/configs/tmpksxb5ocz' && Rscript '/tmp/tmp6tyncd2s/job_working_directory/000/64/configs/tmpksxb5ocz'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmp6tyncd2s/files/6/2/3/dataset_623945d4-e837-4d9e-aa89-7afb60e783eb.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmp6tyncd2s/job_working_directory/000/64/outputs/dataset_c801a73a-4c99-43ca-8a90-89d3cd19bf27.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3b17a7a11ef842069e4c1442b15" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "Scaffold number" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Cumulative Size (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>

      - **Step 3: Name of primary assembly**:

         * step_state: scheduled

      - **Step 4: Name of alternate assembly**:

         * step_state: scheduled

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmp6tyncd2s/files/6/c/c/dataset_6cc2f442-9a1b-4a99-9e47-6d8cca45cc55.dat" "/tmp/tmp6tyncd2s/job_working_directory/000/58/outputs/dataset_29709865-4dd8-4323-a54d-41f2c80a5755.dat" "Hap1" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3b17a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap1" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmp6tyncd2s/files/0/b/9/dataset_0b930632-a736-41d7-b8fe-d1188628498e.dat" "/tmp/tmp6tyncd2s/job_working_directory/000/59/outputs/dataset_06903335-63e3-41ee-a944-1c662d233ff5.dat" "Hap2" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3b17a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap2" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cat/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmp6tyncd2s/files/2/9/7/dataset_29709865-4dd8-4323-a54d-41f2c80a5755.dat' >> '/tmp/tmp6tyncd2s/job_working_directory/000/60/outputs/dataset_5faa067c-326a-43b1-8780-dbbeb6c5ed97.dat' && cat '/tmp/tmp6tyncd2s/files/0/6/9/dataset_06903335-63e3-41ee-a944-1c662d233ff5.dat' >> '/tmp/tmp6tyncd2s/job_working_directory/000/60/outputs/dataset_5faa067c-326a-43b1-8780-dbbeb6c5ed97.dat' && exit 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3b17a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | queries | ` [{"__index__": 0, "inputs2": {"values": [{"id": 105, "src": "hda"}]}}] ` |

           </details>

      - **Step 8: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmp6tyncd2s/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmp6tyncd2s/files/5/f/a/dataset_5faa067c-326a-43b1-8780-dbbeb6c5ed97.dat' 'c8,c5,c6' T '/tmp/tmp6tyncd2s/job_working_directory/000/61/outputs/dataset_9c0df3ca-4c3d-4d72-8a89-e17c83965001.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3b17a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c5,c6" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 9: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmp6tyncd2s/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmp6tyncd2s/files/5/f/a/dataset_5faa067c-326a-43b1-8780-dbbeb6c5ed97.dat' 'c8,c4,c7' T '/tmp/tmp6tyncd2s/job_working_directory/000/62/outputs/dataset_623945d4-e837-4d9e-aa89-7afb60e783eb.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3b17a7a11ef842069e4c1442b15" ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c4,c7" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 10: Nx Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmp6tyncd2s/job_working_directory/000/63/configs/tmpe7syjz3n' && Rscript '/tmp/tmp6tyncd2s/job_working_directory/000/63/configs/tmpe7syjz3n'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmp6tyncd2s/files/9/c/0/dataset_9c0df3ca-4c3d-4d72-8a89-e17c83965001.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmp6tyncd2s/job_working_directory/000/63/outputs/dataset_3a11c67f-c524-4619-a3d7-e95e3cb89799.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3b17a7a11ef842069e4c1442b15" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "x" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Nx (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>
       </details>

 - **Step 43: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmp6tyncd2s/files/a/c/2/dataset_ac28c65f-5835-40e7-9a6a-a13879979a12.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-09-24 13:58:11 ERROR:   Something went wrong. Results not recorded.
           2024-09-24 13:58:11 ERROR:   BUSCO analysis failed!
           2024-09-24 13:58:11 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-09-24 13:47:31 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 09/24/2024 13:47:31 *****
           2024-09-24 13:47:31 INFO:    Configuring BUSCO with local environment
           2024-09-24 13:47:31 INFO:    Running genome mode
           2024-09-24 13:47:55 INFO:    Input file is /tmp/tmp6tyncd2s/files/a/c/2/dataset_ac28c65f-5835-40e7-9a6a-a13879979a12.dat
           2024-09-24 13:47:55 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-09-24 13:47:55 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-09-24 13:47:55 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-09-24 13:47:55 INFO:    Running 1 job(s) on bbtools, starting at 09/24/2024 13:47:55
           2024-09-24 13:47:57 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-09-24 13:47:57 INFO:    Running 1 job(s) on miniprot_index, starting at 09/24/2024 13:47:57
           2024-09-24 13:47:57 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-09-24 13:47:57 INFO:    Running 1 job(s) on miniprot_align, starting at 09/24/2024 13:47:57
           2024-09-24 13:57:51 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-09-24 13:57:54 INFO:    ***** Run HMMER on gene sequences *****
           2024-09-24 13:57:55 INFO:    Running 395 job(s) on hmmsearch, starting at 09/24/2024 13:57:55
           2024-09-24 13:57:58 INFO:    [hmmsearch] 40 of 395 task(s) completed
           2024-09-24 13:57:59 INFO:    [hmmsearch] 79 of 395 task(s) completed
           2024-09-24 13:58:01 INFO:    [hmmsearch] 119 of 395 task(s) completed
           2024-09-24 13:58:02 INFO:    [hmmsearch] 158 of 395 task(s) completed
           2024-09-24 13:58:04 INFO:    [hmmsearch] 198 of 395 task(s) completed
           2024-09-24 13:58:05 INFO:    [hmmsearch] 237 of 395 task(s) completed
           2024-09-24 13:58:06 INFO:    [hmmsearch] 277 of 395 task(s) completed
           2024-09-24 13:58:08 INFO:    [hmmsearch] 316 of 395 task(s) completed
           2024-09-24 13:58:09 INFO:    [hmmsearch] 356 of 395 task(s) completed
           2024-09-24 13:58:11 INFO:    [hmmsearch] 395 of 395 task(s) completed
           2024-09-24 13:58:11 INFO:    21 exons in total
           2024-09-24 13:58:11 WARNING: 1 of 16 Complete matches (6.2%) contain internal stop codons in Miniprot gene predictions

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 44: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy4**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           mkdir -p output_files && mkdir -p read-db.meryl && tar -zxf /tmp/tmp6tyncd2s/files/8/9/9/dataset_8997ea51-0951-408f-853f-63ac3098d874.dat -C read-db.meryl --strip-components=1 && ln -s '/tmp/tmp6tyncd2s/files/4/4/7/dataset_4473ea14-b23c-40e9-b824-2d976c477d20.dat' assembly_01.fasta && ln -s '/tmp/tmp6tyncd2s/files/a/c/2/dataset_ac28c65f-5835-40e7-9a6a-a13879979a12.dat' assembly_02.fasta && merqury.sh read-db.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmp6tyncd2s/job_working_directory/000/44/outputs/dataset_6ccde2c2-f37c-4db7-93bb-55e49c895cf1.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | label | ` "output_merqury" ` |
             | mode | ` {"__current_case__": 0, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 49, "src": "hda"}]}, "assembly_02": {"values": [{"id": 48, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 5, "src": "hda"}]}, "options": "default"} ` |
             | output\_add\_headers | ` true ` |
             | output\_selector | ` ["qv", "plots", "stats", "log", "hist"] ` |

      </details>

 - **Step 45: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmp6tyncd2s/files/4/4/7/dataset_4473ea14-b23c-40e9-b824-2d976c477d20.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-09-24 14:04:29 ERROR:   Something went wrong. Results not recorded.
           2024-09-24 14:04:29 ERROR:   BUSCO analysis failed!
           2024-09-24 14:04:29 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-09-24 13:47:31 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 09/24/2024 13:47:31 *****
           2024-09-24 13:47:31 INFO:    Configuring BUSCO with local environment
           2024-09-24 13:47:31 INFO:    Running genome mode
           2024-09-24 13:47:55 INFO:    Input file is /tmp/tmp6tyncd2s/files/4/4/7/dataset_4473ea14-b23c-40e9-b824-2d976c477d20.dat
           2024-09-24 13:47:55 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-09-24 13:47:55 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-09-24 13:47:55 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-09-24 13:47:55 INFO:    Running 1 job(s) on bbtools, starting at 09/24/2024 13:47:55
           2024-09-24 13:47:57 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-09-24 13:47:57 INFO:    Running 1 job(s) on miniprot_index, starting at 09/24/2024 13:47:57
           2024-09-24 13:47:58 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-09-24 13:47:58 INFO:    Running 1 job(s) on miniprot_align, starting at 09/24/2024 13:47:58
           2024-09-24 14:04:04 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-09-24 14:04:10 INFO:    ***** Run HMMER on gene sequences *****
           2024-09-24 14:04:10 INFO:    Running 584 job(s) on hmmsearch, starting at 09/24/2024 14:04:10
           2024-09-24 14:04:14 INFO:    [hmmsearch] 59 of 584 task(s) completed
           2024-09-24 14:04:16 INFO:    [hmmsearch] 117 of 584 task(s) completed
           2024-09-24 14:04:17 INFO:    [hmmsearch] 176 of 584 task(s) completed
           2024-09-24 14:04:19 INFO:    [hmmsearch] 234 of 584 task(s) completed
           2024-09-24 14:04:21 INFO:    [hmmsearch] 292 of 584 task(s) completed
           2024-09-24 14:04:22 INFO:    [hmmsearch] 351 of 584 task(s) completed
           2024-09-24 14:04:24 INFO:    [hmmsearch] 409 of 584 task(s) completed
           2024-09-24 14:04:25 INFO:    [hmmsearch] 468 of 584 task(s) completed
           2024-09-24 14:04:27 INFO:    [hmmsearch] 526 of 584 task(s) completed
           2024-09-24 14:04:29 INFO:    [hmmsearch] 584 of 584 task(s) completed
           2024-09-24 14:04:29 INFO:    42 exons in total
           2024-09-24 14:04:29 WARNING: 2 of 33 Complete matches (6.1%) contain internal stop codons in Miniprot gene predictions
           2024-09-24 14:04:29 WARNING: BUSCO gene predictions from Miniprot have low average identity (0.4399999976158142). You may want to repeat the analysis using the Metaeuk pipeline.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 46: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cut\_tool/9.3+galaxy2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cut --complement -f '3' '/tmp/tmp6tyncd2s/files/c/9/6/dataset_c96980fa-0dcb-4030-94cb-03a7560069f8.dat' > '/tmp/tmp6tyncd2s/job_working_directory/000/46/outputs/dataset_21c5531b-34e7-4e22-8417-3e7d13152974.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | complement | ` "--complement" ` |
             | cut\_type\_options | ` {"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""} ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 47: output_merqury.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 48: output_merqury.spectra-asm.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 49: merqury_qv**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | input | ` {"values": [{"id": 6, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 50: output_merqury.assembly_01.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 6: Database for Busco Lineage**:

    * step_state: scheduled

 - **Step 51: merqury_stats**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | input | ` {"values": [{"id": 8, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 52: output_merqury.assembly_02.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 53: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_find\_and\_replace/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmp6tyncd2s/job_working_directory/000/47/outputs/dataset_5953784a-5e90-46d4-80a2-663e0a800ffd.dat' -g     '#' 'Number of' '/tmp/tmp6tyncd2s/files/2/1/c/dataset_21c5531b-34e7-4e22-8417-3e7d13152974.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "63d3e3ae7a7a11ef842069e4c1442b15" ` |
             | chromInfo | ` "/tmp/tmp6tyncd2s/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | find\_and\_replace | ` [{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}] ` |

      </details>

 - **Step 7: Lineage**:

    * step_state: scheduled

 - **Step 8: Name for Haplotype 1**:

    * step_state: scheduled

 - **Step 9: Name for Haplotype 2**:

    * step_state: scheduled

 - **Step 10: Bits for bloom filter**:

    * step_state: scheduled

  </details>
  • Other invocation details - **history_id** * ae222cc7a1599fb1 - **history_state** * ok - **invocation_id** * ae222cc7a1599fb1 - **invocation_state** * scheduled - **workflow_id** * c0dd4d8b9ca0f7c7

gxydevbot commented 2 weeks ago

There are new updates, they have been integrated to the PR, check the file diff.

github-actions[bot] commented 2 weeks ago

Test Results (powered by Planemo)

Test Summary

Test State Count
Total 1
Passed 0
Error 0
Failure 1
Skipped 0
Failed Tests *
❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0
**Problems**: * ``` Output with path /tmp/tmpbos7krxh/Busco on data 54 short summary__b9c6f35a-ef0b-491c-b0f7-aa5c93c4347c different than expected Expected text 'C:1.0%[S:1.0%,D:0.0%],F:0.4%,M:98.6%,n:3354' in output ('# BUSCO version is: 5.7.1 # The lineage dataset is: vertebrata_odb10 (Creation date: 2021-02-19, number of genomes: 67, number of BUSCOs: 3354) # Summarized benchmarking in BUSCO notation for file /tmp/tmpo0vv9u4y/files/1/7/8/dataset_1782e445-c540-4aa2-ae92-9212584e75b7.dat # BUSCO was run in mode: euk_genome_min # Gene predictor used: miniprot ***** Results: ***** C:1.0%[S:1.0%,D:0.0%],F:0.1%,M:98.9%,n:3354,E:6.1% 33 Complete BUSCOs (C) (of which 2 contain internal stop codons) 32 Complete and single-copy BUSCOs (S) 1 Complete and duplicated BUSCOs (D) 3 Fragmented BUSCOs (F) 3318 Missing BUSCOs (M) 3354 Total BUSCO groups searched Assembly Statistics: 72 Number of scaffolds 72 Number of contigs 1778748 Total length 0.000% Percent gaps 22 KB Scaffold N50 22 KB Contigs N50 Dependencies and versions: hmmsearch: 3.1 bbtools: None miniprot_index: 0.13-r248 miniprot_align: 0.13-r248 python: sys.version_info(major=3, minor=9, micro=19, releaselevel='final', serial=0) busco: 5.7.1 ') ``` #### Workflow invocation details * Invocation Messages *
Steps - **Step 1: Pacbio Reads Collection**: * step_state: scheduled - **Step 2: HiC forward reads**: * step_state: scheduled - **Step 11: SAK input file**: * step_state: scheduled - **Step 12: Homozygous Read Coverage**: * step_state: scheduled - **Step 13: Genomescope Model Parameters**: * step_state: scheduled - **Step 14: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1**: * step_state: scheduled *
Jobs - **Job 1:** * Job state is ok **Command Line:** * ```console ln -f -s '/tmp/tmpo0vv9u4y/files/d/0/6/dataset_d062bf92-cf97-4937-ad74-7278a11b23d1.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' && cutadapt -j=${GALAXY_SLOTS:-4} -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT' -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT' --error-rate=0.1 --times=1 --overlap=35 --action=trim --rc --discard-trimmed --minimum-length=1 --json=stats.json -o 'out1.fq.gz' 'yeast_reads_sub1_fastq_gz.fq.gz' > report.txt ``` **Exit Code:** * ```console 0 ``` **Traceback:** * ```console ``` **Job Parameters:** * | Job parameter | Parameter value | | ------------- | --------------- | | \_\_input\_ext | ` "input" ` | | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` | | adapter\_options | ` {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"} ` | | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` | | dbkey | ` "?" ` | | filter\_options | ` {"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"} ` | | library | ` {"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"} ` | | other\_trimming\_options | ` {"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false} ` | | output\_selector | ` ["report", "json_stats"] ` | | read\_mod\_options | ` {"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false} ` | 
 - **Step 15: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_grep\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpo0vv9u4y/files/6/5/7/dataset_6572332f-bf0b-486b-ac36-98e62451d9ab.dat' > '/tmp/tmpo0vv9u4y/job_working_directory/000/8/outputs/dataset_c647a4e2-d983-4bfb-8cb5-2b3279a7f89f.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | case\_sensitive | ` "-i" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | color | ` "NOCOLOR" ` |
             | dbkey | ` "?" ` |
             | invert | ` "" ` |
             | lines\_after | ` "0" ` |
             | lines\_before | ` "0" ` |
             | regex\_type | ` "-G" ` |
             | url\_paste | ` "Haploid" ` |

      </details>

 - **Step 16: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmpo0vv9u4y/job_working_directory/000/9/configs/tmpa5jqogj8' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpo0vv9u4y/files/5/5/9/dataset_559be4cf-0535-4a4e-91da-ae5baae96b79.dat' '/tmp/tmpo0vv9u4y/job_working_directory/000/9/outputs/dataset_19ee79bd-962d-4ec7-97d1-42534f021598.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           c3*2
           Computing 1 new columns with instructions ['c3*2;;']
           Computed new column values for 100.00% of 1 lines written.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | avoid\_scientific\_notation | ` false ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
             | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"} ` |

      </details>

 - **Step 17: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpo0vv9u4y/files/0/3/1/dataset_0310103e-dda5-460b-b661-f598971b86e7.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console

           /// MultiQC 🔍 v1.24.1

                version_check | MultiQC Version v1.25.1 now available!
                  file_search | Search path: /tmp/tmpo0vv9u4y/job_working_directory/000/10/working/multiqc_WDir

                     cutadapt | Found 1 reports

                write_results | Data        : report_data
                write_results | Report      : report.html
                      multiqc | MultiQC complete

           ```
        **Standard Output:**

         * ```console
           total 72
           -rw-r--r-- 1 1001 118    93 Oct 14 04:31 cutadapt_filtered_reads_plot.txt
           -rw-r--r-- 1 1001 118    66 Oct 14 04:31 cutadapt_trimmed_sequences_plot_default_Counts.txt
           -rw-r--r-- 1 1001 118    70 Oct 14 04:31 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
           -rw-r--r-- 1 1001 118   124 Oct 14 04:31 multiqc_citations.txt
           -rw-r--r-- 1 1001 118   222 Oct 14 04:31 multiqc_cutadapt.txt
           -rw-r--r-- 1 1001 118 39114 Oct 14 04:31 multiqc_data.json
           -rw-r--r-- 1 1001 118   105 Oct 14 04:31 multiqc_general_stats.txt
           -rw-r--r-- 1 1001 118    29 Oct 14 04:31 multiqc_software_versions.txt
           -rw-r--r-- 1 1001 118   194 Oct 14 04:31 multiqc_sources.txt

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | comment | ` "" ` |
             | dbkey | ` "?" ` |
             | export | ` false ` |
             | flat | ` false ` |
             | results | ` [{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}] ` |
             | saveLog | ` "false" ` |
             | title | ` "" ` |

      </details>

 - **Step 18: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_replace\_in\_line/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmpo0vv9u4y/files/c/6/4/dataset_c647a4e2-d983-4bfb-8cb5-2b3279a7f89f.dat' > '/tmp/tmpo0vv9u4y/job_working_directory/000/11/outputs/dataset_51592095-8103-456a-ab49-3f2ffbf5d694.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | replacements | ` [{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}] ` |

      </details>

 - **Step 19: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmpo0vv9u4y/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpo0vv9u4y/files/1/9/e/dataset_19ee79bd-962d-4ec7-97d1-42534f021598.dat' 'c7' T '/tmp/tmpo0vv9u4y/job_working_directory/000/12/outputs/dataset_5cae8db1-a53d-4eda-b28e-6435a21adc59.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c7" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 20: Convert characters1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python /tmp/tmpo0vv9u4y/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmpo0vv9u4y/files/5/1/5/dataset_51592095-8103-456a-ab49-3f2ffbf5d694.dat s /tmp/tmpo0vv9u4y/job_working_directory/000/13/outputs/dataset_8134e79d-e912-419f-8112-982a6e3f6fbe.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "txt" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | condense | ` true ` |
             | convert\_from | ` "s" ` |
             | dbkey | ` "?" ` |
             | strip | ` true ` |

      </details>

 - **Step 3: HiC reverse reads**:

    * step_state: scheduled

 - **Step 21: Estimated homozygous read coverage**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 22: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmpo0vv9u4y/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpo0vv9u4y/files/8/1/3/dataset_8134e79d-e912-419f-8112-982a6e3f6fbe.dat' 'c3' T '/tmp/tmpo0vv9u4y/job_working_directory/000/15/outputs/dataset_0b18ec95-645a-4d2e-83d4-b564bc8519f0.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c3" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 23: Homozygous read coverage for Hifiasm**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | style\_cond | ` {"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}} ` |

      </details>

 - **Step 24: Estimated genome size**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 25: toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.9+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmpo0vv9u4y/files/e/2/b/dataset_e2b2159a-7470-4ab7-9d8b-b71a6b3a79a2.dat' input_0.fastq.gz &&  mkdir HiCF HiCR && ln -s '/tmp/tmpo0vv9u4y/files/3/e/1/dataset_3e13a143-36bd-4f2b-90ed-4a16d411c7da.dat' ./HiCF/input_0.fastqsanger.gz &&  ln -s '/tmp/tmpo0vv9u4y/files/9/6/f/dataset_96fbfd43-c0e6-4129-bf2a-6b9ff242e269.dat' ./HiCR/input_0.fastqsanger.gz &&  hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21  --h1 './HiCF/input_0.fastqsanger.gz' --h2 './HiCR/input_0.fastqsanger.gz' --l-msjoin 500000   --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "fastq.gz" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | advanced\_options | ` {"__current_case__": 0, "advanced_selector": "blank"} ` |
             | assembly\_options | ` {"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"} ` |
             | bins\_out | ` false ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filter\_bits | ` "32" ` |
             | hic\_partition | ` {"__current_case__": 1, "f_perturb": null, "h1": {"values": [{"id": 1, "src": "hda"}]}, "h2": {"values": [{"id": 2, "src": "hda"}]}, "hic_partition_selector": "set", "l_msjoin": "500000", "n_perturb": null, "n_weight": null, "seed": null} ` |
             | log\_out | ` true ` |
             | mode | ` {"__current_case__": 0, "mode_selector": "standard", "reads": {"values": [{"id": 2, "src": "hdca"}]}} ` |
             | ont\_integration | ` {"__current_case__": 0, "ont_integration_selector": "blank"} ` |
             | purge\_options | ` {"__current_case__": 0, "purge_selector": "blank"} ` |
             | scaffolding\_options | ` {"__current_case__": 0, "scaffold_selector": "blank"} ` |

      </details>

 - **Step 26: Raw Unitig Image**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmpo0vv9u4y/files/8/b/0/dataset_8b0c9f67-6f07-4cc7-a2f5-98142174a399.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | fontsize | ` None ` |
             | height | ` "2000" ` |
             | lengths | ` false ` |
             | names | ` false ` |
             | nodewidth | ` "25.0" ` |
             | output\_format | ` "png" ` |
             | width | ` None ` |

      </details>

 - **Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpo0vv9u4y/files/8/1/5/dataset_81536b54-20b5-44c8-865f-ba55f762a8b6.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpo0vv9u4y/job_working_directory/000/20/outputs/dataset_1fa67b06-d36b-4fe6-bf98-d13cf7edef93.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 28: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpo0vv9u4y/files/7/a/e/dataset_7ae59a31-509a-444b-a661-24ee71b59da6.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpo0vv9u4y/job_working_directory/000/21/outputs/dataset_0090697f-95d8-4f38-8bd7-86f14c059088.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 29: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpo0vv9u4y/files/8/1/5/dataset_81536b54-20b5-44c8-865f-ba55f762a8b6.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpo0vv9u4y/job_working_directory/000/22/outputs/dataset_0bdb8e0a-d262-40dc-9cea-6f9f9866bb54.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 30: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpo0vv9u4y/files/8/1/5/dataset_81536b54-20b5-44c8-865f-ba55f762a8b6.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 4: Genomescope Summary**:

    * step_state: scheduled

 - **Step 31: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpo0vv9u4y/files/7/a/e/dataset_7ae59a31-509a-444b-a661-24ee71b59da6.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpo0vv9u4y/job_working_directory/000/24/outputs/dataset_bb9df094-00f3-4cef-9343-c38b6d4fcbe3.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpo0vv9u4y/files/7/a/e/dataset_7ae59a31-509a-444b-a661-24ee71b59da6.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpo0vv9u4y/files/8/1/5/dataset_81536b54-20b5-44c8-865f-ba55f762a8b6.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpo0vv9u4y/files/7/a/e/dataset_7ae59a31-509a-444b-a661-24ee71b59da6.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 35: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmpo0vv9u4y/job_working_directory/000/28/configs/tmpm8_jq37m' '/tmp/tmpo0vv9u4y/files/1/f/a/dataset_1fa67b06-d36b-4fe6-bf98-d13cf7edef93.dat' > '/tmp/tmpo0vv9u4y/job_working_directory/000/28/outputs/dataset_a3675ad9-1951-463c-9b5f-8e30cadc4ff5.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap2\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmpo0vv9u4y/job_working_directory/000/29/configs/tmphikqugtz' '/tmp/tmpo0vv9u4y/files/0/0/9/dataset_0090697f-95d8-4f38-8bd7-86f14c059088.dat' > '/tmp/tmpo0vv9u4y/job_working_directory/000/29/outputs/dataset_df4f96e0-ee58-4269-b143-b4fe63ef685b.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap1\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 37: Data Prep Hap2**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmpo0vv9u4y/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpo0vv9u4y/files/0/b/d/dataset_0bdb8e0a-d262-40dc-9cea-6f9f9866bb54.dat' --output='/tmp/tmpo0vv9u4y/job_working_directory/000/30/outputs/dataset_3be745f4-3f4c-4035-bfef-4347e8a8eb99.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2389e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmpo0vv9u4y/job_working_directory/000/31/configs/tmpnrjlrtsm' '/tmp/tmpo0vv9u4y/files/3/b/e/dataset_3be745f4-3f4c-4035-bfef-4347e8a8eb99.dat' > '/tmp/tmpo0vv9u4y/job_working_directory/000/31/outputs/dataset_016cfd97-cd91-4b55-a84a-16decebf4759.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2389e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmpo0vv9u4y/files/0/1/6/dataset_016cfd97-cd91-4b55-a84a-16decebf4759.dat > '/tmp/tmpo0vv9u4y/job_working_directory/000/32/outputs/dataset_ebc34ce6-f9ad-4aed-9df4-ad67fd0d0907.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2389e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpo0vv9u4y/files/0/1/6/dataset_016cfd97-cd91-4b55-a84a-16decebf4759.dat" "/tmp/tmpo0vv9u4y/job_working_directory/000/33/outputs/dataset_9374d967-5d55-4754-b0f6-bfc282258fb5.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2389e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2389e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2389e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1008829", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpo0vv9u4y/job_working_directory/000/57/configs/tmpeziq2i6b' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpo0vv9u4y/files/9/3/7/dataset_9374d967-5d55-4754-b0f6-bfc282258fb5.dat' '/tmp/tmpo0vv9u4y/job_working_directory/000/57/outputs/dataset_8e75aa08-32f6-4c60-967a-5afcf72e2073.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1008829
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1008829;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 35 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2389e411efb6216045bde949e6" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1008829"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 38: Data Prep Hap1**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmpo0vv9u4y/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpo0vv9u4y/files/b/b/9/dataset_bb9df094-00f3-4cef-9343-c38b6d4fcbe3.dat' --output='/tmp/tmpo0vv9u4y/job_working_directory/000/35/outputs/dataset_d229e725-e341-41a6-8fdf-e1262c77a34f.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2489e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmpo0vv9u4y/job_working_directory/000/36/configs/tmp2ba1iz3y' '/tmp/tmpo0vv9u4y/files/d/2/2/dataset_d229e725-e341-41a6-8fdf-e1262c77a34f.dat' > '/tmp/tmpo0vv9u4y/job_working_directory/000/36/outputs/dataset_776886ee-51cc-4912-854c-2c1492c86f7f.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2489e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmpo0vv9u4y/files/7/7/6/dataset_776886ee-51cc-4912-854c-2c1492c86f7f.dat > '/tmp/tmpo0vv9u4y/job_working_directory/000/37/outputs/dataset_2a290468-393f-48ca-ac73-f0f27de98535.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2489e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpo0vv9u4y/files/7/7/6/dataset_776886ee-51cc-4912-854c-2c1492c86f7f.dat" "/tmp/tmpo0vv9u4y/job_working_directory/000/38/outputs/dataset_5d0522bc-6efa-42af-97ad-5fcc48fcfcbe.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2489e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2489e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2489e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1778748", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpo0vv9u4y/job_working_directory/000/56/configs/tmp6gj2pzs6' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpo0vv9u4y/files/5/d/0/dataset_5d0522bc-6efa-42af-97ad-5fcc48fcfcbe.dat' '/tmp/tmpo0vv9u4y/job_working_directory/000/56/outputs/dataset_433b968e-8e81-4540-93c5-2fcb59a82042.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1778748
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1778748;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 72 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2489e411efb6216045bde949e6" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1778748"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 39: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmpo0vv9u4y/job_working_directory/000/40/configs/tmpoiidpdzx' '/tmp/tmpo0vv9u4y/files/9/7/8/dataset_9782fba3-4c15-4306-9b20-9cdd15444780.dat' > '/tmp/tmpo0vv9u4y/job_working_directory/000/40/outputs/dataset_470e8cc6-6042-4410-81e2-d3d550f2b9c8.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 40: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmpo0vv9u4y/job_working_directory/000/41/configs/tmp7vsnv3u0' '/tmp/tmpo0vv9u4y/files/1/d/0/dataset_1d0f8661-d2cf-4473-96c1-d93a3d5308ae.dat' > '/tmp/tmpo0vv9u4y/job_working_directory/000/41/outputs/dataset_1782e445-c540-4aa2-ae92-9212584e75b7.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 5: Meryl Database**:

    * step_state: scheduled

 - **Step 41: join1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/tmpo0vv9u4y/galaxy-dev/tools/filters/join.py' '/tmp/tmpo0vv9u4y/files/d/f/4/dataset_df4f96e0-ee58-4269-b143-b4fe63ef685b.dat' '/tmp/tmpo0vv9u4y/files/a/3/6/dataset_a3675ad9-1951-463c-9b5f-8e30cadc4ff5.dat' 1 1 '/tmp/tmpo0vv9u4y/job_working_directory/000/42/outputs/dataset_06eb1cf8-8de8-412c-80c4-4d4c28f2cc1e.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmpo0vv9u4y/job_working_directory/000/42/configs/tmp7el5sdfu
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | field1 | ` "1" ` |
             | field2 | ` "1" ` |
             | fill\_empty\_columns | ` {"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"} ` |
             | header | ` "" ` |
             | partial | ` "-p" ` |
             | unmatched | ` "-u" ` |

      </details>

 - **Step 42: Plot Data**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: Primary data**:

         * step_state: scheduled

      - **Step 2: Alternate data**:

         * step_state: scheduled

      - **Step 11: Size Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpo0vv9u4y/job_working_directory/000/64/configs/tmplwf9n71_' && Rscript '/tmp/tmpo0vv9u4y/job_working_directory/000/64/configs/tmplwf9n71_'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmpo0vv9u4y/files/d/3/b/dataset_d3b0a252-a2b6-4d2a-ac15-ecfee4a108f5.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmpo0vv9u4y/job_working_directory/000/64/outputs/dataset_d0380b23-9270-40ec-b6f2-00f69de521fd.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2589e411efb6216045bde949e6" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "Scaffold number" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Cumulative Size (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>

      - **Step 3: Name of primary assembly**:

         * step_state: scheduled

      - **Step 4: Name of alternate assembly**:

         * step_state: scheduled

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpo0vv9u4y/files/4/3/3/dataset_433b968e-8e81-4540-93c5-2fcb59a82042.dat" "/tmp/tmpo0vv9u4y/job_working_directory/000/58/outputs/dataset_b0f72df9-3359-45d9-bc88-8b6c03cc941f.dat" "Hap1" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2589e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap1" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpo0vv9u4y/files/8/e/7/dataset_8e75aa08-32f6-4c60-967a-5afcf72e2073.dat" "/tmp/tmpo0vv9u4y/job_working_directory/000/59/outputs/dataset_b70adfc5-f0e9-4af9-9ad6-20501f77749e.dat" "Hap2" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2589e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap2" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cat/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpo0vv9u4y/files/b/0/f/dataset_b0f72df9-3359-45d9-bc88-8b6c03cc941f.dat' >> '/tmp/tmpo0vv9u4y/job_working_directory/000/60/outputs/dataset_0019865b-7c5f-48dc-8219-45d55acc4eb0.dat' && cat '/tmp/tmpo0vv9u4y/files/b/7/0/dataset_b70adfc5-f0e9-4af9-9ad6-20501f77749e.dat' >> '/tmp/tmpo0vv9u4y/job_working_directory/000/60/outputs/dataset_0019865b-7c5f-48dc-8219-45d55acc4eb0.dat' && exit 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2589e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | queries | ` [{"__index__": 0, "inputs2": {"values": [{"id": 105, "src": "hda"}]}}] ` |

           </details>

      - **Step 8: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmpo0vv9u4y/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpo0vv9u4y/files/0/0/1/dataset_0019865b-7c5f-48dc-8219-45d55acc4eb0.dat' 'c8,c5,c6' T '/tmp/tmpo0vv9u4y/job_working_directory/000/61/outputs/dataset_934b2dfb-5c1f-48f5-bc89-d73ea4572100.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2589e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c5,c6" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 9: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmpo0vv9u4y/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpo0vv9u4y/files/0/0/1/dataset_0019865b-7c5f-48dc-8219-45d55acc4eb0.dat' 'c8,c4,c7' T '/tmp/tmpo0vv9u4y/job_working_directory/000/62/outputs/dataset_d3b0a252-a2b6-4d2a-ac15-ecfee4a108f5.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2589e411efb6216045bde949e6" ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c4,c7" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 10: Nx Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpo0vv9u4y/job_working_directory/000/63/configs/tmp_e_3ik6z' && Rscript '/tmp/tmpo0vv9u4y/job_working_directory/000/63/configs/tmp_e_3ik6z'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmpo0vv9u4y/files/9/3/4/dataset_934b2dfb-5c1f-48f5-bc89-d73ea4572100.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmpo0vv9u4y/job_working_directory/000/63/outputs/dataset_4f0b4968-8e49-4f15-a398-a60c98259e41.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2589e411efb6216045bde949e6" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "x" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Nx (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>
       </details>

 - **Step 43: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmpo0vv9u4y/files/4/7/0/dataset_470e8cc6-6042-4410-81e2-d3d550f2b9c8.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-10-14 04:49:40 ERROR:   Something went wrong. Results not recorded.
           2024-10-14 04:49:40 ERROR:   BUSCO analysis failed!
           2024-10-14 04:49:40 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-10-14 04:39:19 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 10/14/2024 04:39:19 *****
           2024-10-14 04:39:19 INFO:    Configuring BUSCO with local environment
           2024-10-14 04:39:19 INFO:    Running genome mode
           2024-10-14 04:39:21 INFO:    Input file is /tmp/tmpo0vv9u4y/files/4/7/0/dataset_470e8cc6-6042-4410-81e2-d3d550f2b9c8.dat
           2024-10-14 04:39:21 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-10-14 04:39:21 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-10-14 04:39:21 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-10-14 04:39:21 INFO:    Running 1 job(s) on bbtools, starting at 10/14/2024 04:39:21
           2024-10-14 04:39:22 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-10-14 04:39:22 INFO:    Running 1 job(s) on miniprot_index, starting at 10/14/2024 04:39:22
           2024-10-14 04:39:23 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-10-14 04:39:23 INFO:    Running 1 job(s) on miniprot_align, starting at 10/14/2024 04:39:23
           2024-10-14 04:49:00 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-10-14 04:49:02 INFO:    ***** Run HMMER on gene sequences *****
           2024-10-14 04:49:03 INFO:    Running 395 job(s) on hmmsearch, starting at 10/14/2024 04:49:03
           2024-10-14 04:49:08 INFO:    [hmmsearch] 40 of 395 task(s) completed
           2024-10-14 04:49:12 INFO:    [hmmsearch] 79 of 395 task(s) completed
           2024-10-14 04:49:15 INFO:    [hmmsearch] 119 of 395 task(s) completed
           2024-10-14 04:49:19 INFO:    [hmmsearch] 158 of 395 task(s) completed
           2024-10-14 04:49:23 INFO:    [hmmsearch] 198 of 395 task(s) completed
           2024-10-14 04:49:26 INFO:    [hmmsearch] 237 of 395 task(s) completed
           2024-10-14 04:49:29 INFO:    [hmmsearch] 277 of 395 task(s) completed
           2024-10-14 04:49:33 INFO:    [hmmsearch] 316 of 395 task(s) completed
           2024-10-14 04:49:36 INFO:    [hmmsearch] 356 of 395 task(s) completed
           2024-10-14 04:49:40 INFO:    [hmmsearch] 395 of 395 task(s) completed
           2024-10-14 04:49:40 INFO:    21 exons in total
           2024-10-14 04:49:40 WARNING: 1 of 16 Complete matches (6.2%) contain internal stop codons in Miniprot gene predictions

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 44: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy4**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           mkdir -p output_files && mkdir -p read-db.meryl && tar -zxf /tmp/tmpo0vv9u4y/files/f/0/5/dataset_f05a0528-a4c6-4a44-a86f-598135508474.dat -C read-db.meryl --strip-components=1 && ln -s '/tmp/tmpo0vv9u4y/files/1/7/8/dataset_1782e445-c540-4aa2-ae92-9212584e75b7.dat' assembly_01.fasta && ln -s '/tmp/tmpo0vv9u4y/files/4/7/0/dataset_470e8cc6-6042-4410-81e2-d3d550f2b9c8.dat' assembly_02.fasta && merqury.sh read-db.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmpo0vv9u4y/job_working_directory/000/44/outputs/dataset_9c66df99-8742-4190-a9e7-d4d4744615bd.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | label | ` "output_merqury" ` |
             | mode | ` {"__current_case__": 0, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 49, "src": "hda"}]}, "assembly_02": {"values": [{"id": 48, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 5, "src": "hda"}]}, "options": "default"} ` |
             | output\_add\_headers | ` true ` |
             | output\_selector | ` ["qv", "plots", "stats", "log", "hist"] ` |

      </details>

 - **Step 45: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmpo0vv9u4y/files/1/7/8/dataset_1782e445-c540-4aa2-ae92-9212584e75b7.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-10-14 04:55:52 ERROR:   Something went wrong. Results not recorded.
           2024-10-14 04:55:52 ERROR:   BUSCO analysis failed!
           2024-10-14 04:55:52 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-10-14 04:39:19 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 10/14/2024 04:39:19 *****
           2024-10-14 04:39:19 INFO:    Configuring BUSCO with local environment
           2024-10-14 04:39:19 INFO:    Running genome mode
           2024-10-14 04:39:21 INFO:    Input file is /tmp/tmpo0vv9u4y/files/1/7/8/dataset_1782e445-c540-4aa2-ae92-9212584e75b7.dat
           2024-10-14 04:39:21 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-10-14 04:39:21 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-10-14 04:39:21 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-10-14 04:39:21 INFO:    Running 1 job(s) on bbtools, starting at 10/14/2024 04:39:21
           2024-10-14 04:39:22 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-10-14 04:39:22 INFO:    Running 1 job(s) on miniprot_index, starting at 10/14/2024 04:39:22
           2024-10-14 04:39:23 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-10-14 04:39:23 INFO:    Running 1 job(s) on miniprot_align, starting at 10/14/2024 04:39:23
           2024-10-14 04:55:15 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-10-14 04:55:20 INFO:    ***** Run HMMER on gene sequences *****
           2024-10-14 04:55:21 INFO:    Running 584 job(s) on hmmsearch, starting at 10/14/2024 04:55:21
           2024-10-14 04:55:26 INFO:    [hmmsearch] 59 of 584 task(s) completed
           2024-10-14 04:55:29 INFO:    [hmmsearch] 117 of 584 task(s) completed
           2024-10-14 04:55:32 INFO:    [hmmsearch] 176 of 584 task(s) completed
           2024-10-14 04:55:35 INFO:    [hmmsearch] 234 of 584 task(s) completed
           2024-10-14 04:55:38 INFO:    [hmmsearch] 292 of 584 task(s) completed
           2024-10-14 04:55:41 INFO:    [hmmsearch] 351 of 584 task(s) completed
           2024-10-14 04:55:44 INFO:    [hmmsearch] 409 of 584 task(s) completed
           2024-10-14 04:55:46 INFO:    [hmmsearch] 468 of 584 task(s) completed
           2024-10-14 04:55:49 INFO:    [hmmsearch] 526 of 584 task(s) completed
           2024-10-14 04:55:52 INFO:    [hmmsearch] 584 of 584 task(s) completed
           2024-10-14 04:55:52 INFO:    42 exons in total
           2024-10-14 04:55:52 WARNING: 2 of 33 Complete matches (6.1%) contain internal stop codons in Miniprot gene predictions
           2024-10-14 04:55:52 WARNING: BUSCO gene predictions from Miniprot have low average identity (0.4399999976158142). You may want to repeat the analysis using the Metaeuk pipeline.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 46: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cut\_tool/9.3+galaxy2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cut --complement -f '3' '/tmp/tmpo0vv9u4y/files/0/6/e/dataset_06eb1cf8-8de8-412c-80c4-4d4c28f2cc1e.dat' > '/tmp/tmpo0vv9u4y/job_working_directory/000/46/outputs/dataset_c701ad3f-3952-41a2-890b-6705e0066a43.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | complement | ` "--complement" ` |
             | cut\_type\_options | ` {"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""} ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 47: output_merqury.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 48: output_merqury.spectra-asm.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 49: merqury_qv**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | input | ` {"values": [{"id": 6, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 50: output_merqury.assembly_01.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 6: Database for Busco Lineage**:

    * step_state: scheduled

 - **Step 51: merqury_stats**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | input | ` {"values": [{"id": 8, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 52: output_merqury.assembly_02.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 53: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_find\_and\_replace/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmpo0vv9u4y/job_working_directory/000/47/outputs/dataset_e700491d-1996-4dfd-bc90-868a7bec3c5b.dat' -g     '#' 'Number of' '/tmp/tmpo0vv9u4y/files/c/7/0/dataset_c701ad3f-3952-41a2-890b-6705e0066a43.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "e9ab7f2289e411efb6216045bde949e6" ` |
             | chromInfo | ` "/tmp/tmpo0vv9u4y/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | find\_and\_replace | ` [{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}] ` |

      </details>

 - **Step 7: Lineage**:

    * step_state: scheduled

 - **Step 8: Name for Haplotype 1**:

    * step_state: scheduled

 - **Step 9: Name for Haplotype 2**:

    * step_state: scheduled

 - **Step 10: Bits for bloom filter**:

    * step_state: scheduled

  </details>
  • Other invocation details - **history_id** * 883ac5d52a538a01 - **history_state** * ok - **invocation_id** * 883ac5d52a538a01 - **invocation_state** * scheduled - **workflow_id** * 5a0bc04b19f9fdb6

github-actions[bot] commented 6 days ago

Test Results (powered by Planemo)

Test Summary

Test State Count
Total 1
Passed 0
Error 1
Failure 0
Skipped 0
Errored Tests *
❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0
**Execution Problem:** * ``` Unexpected HTTP status code: 400: {"err_msg":"Workflow cannot be run because input step '71' (Collection of Hi-C Forward reads) is not optional and no input provided.","err_code":0} ```

github-actions[bot] commented 6 days ago

Test Results (powered by Planemo)

Test Summary

Test State Count
Total 1
Passed 0
Error 0
Failure 1
Skipped 0
Failed Tests *
❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0
**Problems**: * ``` Output with path /tmp/tmpwmceoeyo/Hifiasm HiC hap1__68e86ebd-bbc2-4e5b-bab7-413a5dfd47a5 different than expected Expected 168+-0 lines in the output found 144 ``` * ``` Output with path /tmp/tmpcqzx4h6j/Busco on data 54 short summary__8dbab94a-e813-4043-8580-695c2928664a different than expected Expected text 'C:1.0%[S:1.0%,D:0.0%],F:0.4%,M:98.6%,n:3354' in output ('# BUSCO version is: 5.7.1 # The lineage dataset is: vertebrata_odb10 (Creation date: 2021-02-19, number of genomes: 67, number of BUSCOs: 3354) # Summarized benchmarking in BUSCO notation for file /tmp/tmponv9oraf/files/6/8/e/dataset_68e86ebd-bbc2-4e5b-bab7-413a5dfd47a5.dat # BUSCO was run in mode: euk_genome_min # Gene predictor used: miniprot ***** Results: ***** C:1.0%[S:1.0%,D:0.0%],F:0.1%,M:98.9%,n:3354,E:6.1% 33 Complete BUSCOs (C) (of which 2 contain internal stop codons) 32 Complete and single-copy BUSCOs (S) 1 Complete and duplicated BUSCOs (D) 3 Fragmented BUSCOs (F) 3318 Missing BUSCOs (M) 3354 Total BUSCO groups searched Assembly Statistics: 72 Number of scaffolds 72 Number of contigs 1778748 Total length 0.000% Percent gaps 22 KB Scaffold N50 22 KB Contigs N50 Dependencies and versions: hmmsearch: 3.1 bbtools: None miniprot_index: 0.13-r248 miniprot_align: 0.13-r248 python: sys.version_info(major=3, minor=9, micro=19, releaselevel='final', serial=0) busco: 5.7.1 ') ``` * ``` Output with path /tmp/tmpr49r2dcf/usable hap1 gfa__a87f18df-2195-4d95-a63b-162a67c198d1 different than expected Expected 173+-0 lines in the output found 145 ``` #### Workflow invocation details * Invocation Messages *
Steps - **Step 1: Pacbio Reads Collection**: * step_state: scheduled - **Step 2: HiC forward reads**: * step_state: scheduled - **Step 11: SAK input file**: * step_state: scheduled - **Step 12: Homozygous Read Coverage**: * step_state: scheduled - **Step 13: Genomescope Model Parameters**: * step_state: scheduled - **Step 14: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1**: * step_state: scheduled *
Jobs - **Job 1:** * Job state is ok **Command Line:** * ```console ln -f -s '/tmp/tmponv9oraf/files/4/a/f/dataset_4af016b3-f329-4f0c-92d7-941b5cdd51fc.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' && cutadapt -j=${GALAXY_SLOTS:-4} -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT' -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT' --error-rate=0.1 --times=1 --overlap=35 --action=trim --rc --discard-trimmed --minimum-length=1 --json=stats.json -o 'out1.fq.gz' 'yeast_reads_sub1_fastq_gz.fq.gz' > report.txt ``` **Exit Code:** * ```console 0 ``` **Traceback:** * ```console ``` **Job Parameters:** * | Job parameter | Parameter value | | ------------- | --------------- | | \_\_input\_ext | ` "input" ` | | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` | | adapter\_options | ` {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"} ` | | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` | | dbkey | ` "?" ` | | filter\_options | ` {"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"} ` | | library | ` {"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"} ` | | other\_trimming\_options | ` {"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false} ` | | output\_selector | ` ["report", "json_stats"] ` | | read\_mod\_options | ` {"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false} ` | 
 - **Step 15: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_grep\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmponv9oraf/files/5/3/2/dataset_53282105-d65b-4f08-afd2-5f26553a2a91.dat' > '/tmp/tmponv9oraf/job_working_directory/000/8/outputs/dataset_ba4da048-3d2e-4cc8-86ed-bc4ecd68fd0f.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | case\_sensitive | ` "-i" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | color | ` "NOCOLOR" ` |
             | dbkey | ` "?" ` |
             | invert | ` "" ` |
             | lines\_after | ` "0" ` |
             | lines\_before | ` "0" ` |
             | regex\_type | ` "-G" ` |
             | url\_paste | ` "Haploid" ` |

      </details>

 - **Step 16: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmponv9oraf/job_working_directory/000/9/configs/tmpbrfbtt3a' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmponv9oraf/files/8/3/7/dataset_83751ff3-d417-4ff2-a043-3eaf082e2b8c.dat' '/tmp/tmponv9oraf/job_working_directory/000/9/outputs/dataset_ad3e06d3-fb49-424e-bbb2-13d4127d80ca.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           c3*2
           Computing 1 new columns with instructions ['c3*2;;']
           Computed new column values for 100.00% of 1 lines written.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | avoid\_scientific\_notation | ` false ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
             | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"} ` |

      </details>

 - **Step 17: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmponv9oraf/files/a/d/d/dataset_add73935-4548-4c84-a6a0-b7b879e459e2.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console

           /// MultiQC 🔍 v1.24.1

                version_check | MultiQC Version v1.25.1 now available!
                  file_search | Search path: /tmp/tmponv9oraf/job_working_directory/000/10/working/multiqc_WDir

                     cutadapt | Found 1 reports

                write_results | Data        : report_data
                write_results | Report      : report.html
                      multiqc | MultiQC complete

           ```
        **Standard Output:**

         * ```console
           total 72
           -rw-r--r-- 1 1001 127    93 Oct 23 18:01 cutadapt_filtered_reads_plot.txt
           -rw-r--r-- 1 1001 127    66 Oct 23 18:01 cutadapt_trimmed_sequences_plot_default_Counts.txt
           -rw-r--r-- 1 1001 127    70 Oct 23 18:01 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
           -rw-r--r-- 1 1001 127   124 Oct 23 18:01 multiqc_citations.txt
           -rw-r--r-- 1 1001 127   222 Oct 23 18:01 multiqc_cutadapt.txt
           -rw-r--r-- 1 1001 127 39114 Oct 23 18:01 multiqc_data.json
           -rw-r--r-- 1 1001 127   105 Oct 23 18:01 multiqc_general_stats.txt
           -rw-r--r-- 1 1001 127    29 Oct 23 18:01 multiqc_software_versions.txt
           -rw-r--r-- 1 1001 127   194 Oct 23 18:01 multiqc_sources.txt

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | comment | ` "" ` |
             | dbkey | ` "?" ` |
             | export | ` false ` |
             | flat | ` false ` |
             | results | ` [{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}] ` |
             | saveLog | ` "false" ` |
             | title | ` "" ` |

      </details>

 - **Step 18: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_replace\_in\_line/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmponv9oraf/files/b/a/4/dataset_ba4da048-3d2e-4cc8-86ed-bc4ecd68fd0f.dat' > '/tmp/tmponv9oraf/job_working_directory/000/11/outputs/dataset_92fb6438-741b-40cf-8d50-dd6a2cd85645.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | replacements | ` [{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}] ` |

      </details>

 - **Step 19: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmponv9oraf/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmponv9oraf/files/a/d/3/dataset_ad3e06d3-fb49-424e-bbb2-13d4127d80ca.dat' 'c7' T '/tmp/tmponv9oraf/job_working_directory/000/12/outputs/dataset_6ae0257f-f687-43c1-9c1e-3ac12560beb9.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c7" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 20: Convert characters1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python /tmp/tmponv9oraf/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmponv9oraf/files/9/2/f/dataset_92fb6438-741b-40cf-8d50-dd6a2cd85645.dat s /tmp/tmponv9oraf/job_working_directory/000/13/outputs/dataset_145c7fca-3e01-4608-919d-2dffd73499f6.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "txt" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | condense | ` true ` |
             | convert\_from | ` "s" ` |
             | dbkey | ` "?" ` |
             | strip | ` true ` |

      </details>

 - **Step 3: HiC reverse reads**:

    * step_state: scheduled

 - **Step 21: Estimated homozygous read coverage**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 22: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmponv9oraf/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmponv9oraf/files/1/4/5/dataset_145c7fca-3e01-4608-919d-2dffd73499f6.dat' 'c3' T '/tmp/tmponv9oraf/job_working_directory/000/15/outputs/dataset_4421dc10-5242-412b-905a-74c241d98128.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c3" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 23: Homozygous read coverage for Hifiasm**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | style\_cond | ` {"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}} ` |

      </details>

 - **Step 24: Estimated genome size**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 25: toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.9+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmponv9oraf/files/5/9/7/dataset_597287e1-05ca-47a1-b604-f2540ab4afbf.dat' input_0.fastq.gz &&  mkdir HiCF HiCR && ln -s '/tmp/tmponv9oraf/files/1/7/5/dataset_17577c69-41ac-427f-9320-8d8df7bc1126.dat' ./HiCF/input_0.fastqsanger.gz &&  ln -s '/tmp/tmponv9oraf/files/7/b/1/dataset_7b19b8fb-91f9-4f90-8fed-8a8c8f0a496d.dat' ./HiCR/input_0.fastqsanger.gz &&  hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21  --h1 './HiCF/input_0.fastqsanger.gz' --h2 './HiCR/input_0.fastqsanger.gz' --l-msjoin 500000   --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "fastq.gz" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | advanced\_options | ` {"__current_case__": 0, "advanced_selector": "blank"} ` |
             | assembly\_options | ` {"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"} ` |
             | bins\_out | ` false ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filter\_bits | ` "32" ` |
             | hic\_partition | ` {"__current_case__": 1, "f_perturb": null, "h1": {"values": [{"id": 1, "src": "hda"}]}, "h2": {"values": [{"id": 2, "src": "hda"}]}, "hic_partition_selector": "set", "l_msjoin": "500000", "n_perturb": null, "n_weight": null, "seed": null} ` |
             | log\_out | ` true ` |
             | mode | ` {"__current_case__": 0, "mode_selector": "standard", "reads": {"values": [{"id": 2, "src": "hdca"}]}} ` |
             | ont\_integration | ` {"__current_case__": 0, "ont_integration_selector": "blank"} ` |
             | purge\_options | ` {"__current_case__": 0, "purge_selector": "blank"} ` |
             | scaffolding\_options | ` {"__current_case__": 0, "scaffold_selector": "blank"} ` |

      </details>

 - **Step 26: Raw Unitig Image**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmponv9oraf/files/8/3/3/dataset_83311e09-34d5-4464-a6a7-8289ce247c7e.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | fontsize | ` None ` |
             | height | ` "2000" ` |
             | lengths | ` false ` |
             | names | ` false ` |
             | nodewidth | ` "25.0" ` |
             | output\_format | ` "png" ` |
             | width | ` None ` |

      </details>

 - **Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmponv9oraf/files/7/c/e/dataset_7cebbdc7-331b-461b-8836-aed6777ea71b.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmponv9oraf/job_working_directory/000/20/outputs/dataset_b998e19b-b5b0-47be-a381-07c957723049.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 28: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmponv9oraf/files/9/7/1/dataset_9710533d-a2bd-47d1-9910-2d154d10da24.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmponv9oraf/job_working_directory/000/21/outputs/dataset_f35e5ab1-f4cf-42a2-a14d-a90e14b8025a.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 29: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmponv9oraf/files/7/c/e/dataset_7cebbdc7-331b-461b-8836-aed6777ea71b.dat' --out-size c  --discover-paths --tabular > '/tmp/tmponv9oraf/job_working_directory/000/22/outputs/dataset_2fff83da-31b6-4b2b-bf44-12f810668374.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 30: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmponv9oraf/files/7/c/e/dataset_7cebbdc7-331b-461b-8836-aed6777ea71b.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 4: Genomescope Summary**:

    * step_state: scheduled

 - **Step 31: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmponv9oraf/files/9/7/1/dataset_9710533d-a2bd-47d1-9910-2d154d10da24.dat' --out-size c  --discover-paths --tabular > '/tmp/tmponv9oraf/job_working_directory/000/24/outputs/dataset_dba6fefd-5afd-44d4-8454-2a4e2d0b78cb.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmponv9oraf/files/9/7/1/dataset_9710533d-a2bd-47d1-9910-2d154d10da24.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmponv9oraf/files/7/c/e/dataset_7cebbdc7-331b-461b-8836-aed6777ea71b.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmponv9oraf/files/9/7/1/dataset_9710533d-a2bd-47d1-9910-2d154d10da24.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 35: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmponv9oraf/job_working_directory/000/28/configs/tmp2m1_2c1u' '/tmp/tmponv9oraf/files/b/9/9/dataset_b998e19b-b5b0-47be-a381-07c957723049.dat' > '/tmp/tmponv9oraf/job_working_directory/000/28/outputs/dataset_f7707681-06b0-46eb-af62-ecee545fb4e9.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap2\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmponv9oraf/job_working_directory/000/29/configs/tmpv6hma1j9' '/tmp/tmponv9oraf/files/f/3/5/dataset_f35e5ab1-f4cf-42a2-a14d-a90e14b8025a.dat' > '/tmp/tmponv9oraf/job_working_directory/000/29/outputs/dataset_1016c83f-e7bd-4717-b2e2-a5b26a22abf0.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap1\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 37: Data Prep Hap2**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmponv9oraf/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmponv9oraf/files/2/f/f/dataset_2fff83da-31b6-4b2b-bf44-12f810668374.dat' --output='/tmp/tmponv9oraf/job_working_directory/000/30/outputs/dataset_4ce6511c-d829-4acc-9010-ea9b030cf3a3.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282d916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmponv9oraf/job_working_directory/000/31/configs/tmpt5jn90es' '/tmp/tmponv9oraf/files/4/c/e/dataset_4ce6511c-d829-4acc-9010-ea9b030cf3a3.dat' > '/tmp/tmponv9oraf/job_working_directory/000/31/outputs/dataset_f4e83c5d-58bf-42a4-aaa3-5a84fd5238c2.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282d916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmponv9oraf/files/f/4/e/dataset_f4e83c5d-58bf-42a4-aaa3-5a84fd5238c2.dat > '/tmp/tmponv9oraf/job_working_directory/000/32/outputs/dataset_8e0f3e73-47ff-49d4-8b1b-19bd17a22797.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282d916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmponv9oraf/files/f/4/e/dataset_f4e83c5d-58bf-42a4-aaa3-5a84fd5238c2.dat" "/tmp/tmponv9oraf/job_working_directory/000/33/outputs/dataset_633ee339-c8a4-4e11-9465-4066b0fe3e2c.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282d916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282d916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282d916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1008829", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmponv9oraf/job_working_directory/000/56/configs/tmpuhiaaevo' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmponv9oraf/files/6/3/3/dataset_633ee339-c8a4-4e11-9465-4066b0fe3e2c.dat' '/tmp/tmponv9oraf/job_working_directory/000/56/outputs/dataset_90d3c1da-fde4-43cd-b179-46ed561c4940.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1008829
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1008829;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 35 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282d916811efb94feb2535e86d06" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1008829"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 38: Data Prep Hap1**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmponv9oraf/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmponv9oraf/files/d/b/a/dataset_dba6fefd-5afd-44d4-8454-2a4e2d0b78cb.dat' --output='/tmp/tmponv9oraf/job_working_directory/000/35/outputs/dataset_36b50e37-93bc-4e57-b1b5-7b473685dba5.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282e916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmponv9oraf/job_working_directory/000/36/configs/tmpmt_ykzfg' '/tmp/tmponv9oraf/files/3/6/b/dataset_36b50e37-93bc-4e57-b1b5-7b473685dba5.dat' > '/tmp/tmponv9oraf/job_working_directory/000/36/outputs/dataset_f07d4459-18a8-4d38-afea-b429cf8db23d.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282e916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmponv9oraf/files/f/0/7/dataset_f07d4459-18a8-4d38-afea-b429cf8db23d.dat > '/tmp/tmponv9oraf/job_working_directory/000/37/outputs/dataset_d490c752-dc76-43ac-9a07-4bdfa5fab75c.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282e916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmponv9oraf/files/f/0/7/dataset_f07d4459-18a8-4d38-afea-b429cf8db23d.dat" "/tmp/tmponv9oraf/job_working_directory/000/38/outputs/dataset_2c3886a9-427e-488e-b6ea-9bfb5b671cac.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282e916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282e916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282e916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1778748", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmponv9oraf/job_working_directory/000/57/configs/tmpf_lwebyp' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmponv9oraf/files/2/c/3/dataset_2c3886a9-427e-488e-b6ea-9bfb5b671cac.dat' '/tmp/tmponv9oraf/job_working_directory/000/57/outputs/dataset_f8d30b75-0a15-4582-857f-22665cf02f9d.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1778748
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1778748;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 72 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282e916811efb94feb2535e86d06" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1778748"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 39: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmponv9oraf/job_working_directory/000/40/configs/tmp1of4224e' '/tmp/tmponv9oraf/files/6/d/4/dataset_6d402410-990b-4499-bf33-c76c48e2d86d.dat' > '/tmp/tmponv9oraf/job_working_directory/000/40/outputs/dataset_554b2a15-fcbe-4f0f-b1b1-f48f8e81fb3e.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 40: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmponv9oraf/job_working_directory/000/41/configs/tmp56_zhqwf' '/tmp/tmponv9oraf/files/0/a/b/dataset_0ab35d0d-fd6d-402f-ba97-3b876cec5f08.dat' > '/tmp/tmponv9oraf/job_working_directory/000/41/outputs/dataset_68e86ebd-bbc2-4e5b-bab7-413a5dfd47a5.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 5: Meryl Database**:

    * step_state: scheduled

 - **Step 41: join1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/tmponv9oraf/galaxy-dev/tools/filters/join.py' '/tmp/tmponv9oraf/files/1/0/1/dataset_1016c83f-e7bd-4717-b2e2-a5b26a22abf0.dat' '/tmp/tmponv9oraf/files/f/7/7/dataset_f7707681-06b0-46eb-af62-ecee545fb4e9.dat' 1 1 '/tmp/tmponv9oraf/job_working_directory/000/42/outputs/dataset_edff8679-31f2-4a35-8ffd-dd62815913f0.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmponv9oraf/job_working_directory/000/42/configs/tmp9t4fzwfs
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | field1 | ` "1" ` |
             | field2 | ` "1" ` |
             | fill\_empty\_columns | ` {"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"} ` |
             | header | ` "" ` |
             | partial | ` "-p" ` |
             | unmatched | ` "-u" ` |

      </details>

 - **Step 42: Plot Data**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: Primary data**:

         * step_state: scheduled

      - **Step 2: Alternate data**:

         * step_state: scheduled

      - **Step 11: Size Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmponv9oraf/job_working_directory/000/64/configs/tmpvzyjnl23' && Rscript '/tmp/tmponv9oraf/job_working_directory/000/64/configs/tmpvzyjnl23'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmponv9oraf/files/1/7/2/dataset_172d982b-1e97-4407-b0d2-0181f7f5ddd9.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmponv9oraf/job_working_directory/000/64/outputs/dataset_d1241aee-abd6-406d-8299-dd6cbccbe2a5.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282f916811efb94feb2535e86d06" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "Scaffold number" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Cumulative Size (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>

      - **Step 3: Name of primary assembly**:

         * step_state: scheduled

      - **Step 4: Name of alternate assembly**:

         * step_state: scheduled

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmponv9oraf/files/f/8/d/dataset_f8d30b75-0a15-4582-857f-22665cf02f9d.dat" "/tmp/tmponv9oraf/job_working_directory/000/58/outputs/dataset_309e1e4e-1c56-429a-aaac-c9f61e289311.dat" "Hap1" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282f916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap1" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmponv9oraf/files/9/0/d/dataset_90d3c1da-fde4-43cd-b179-46ed561c4940.dat" "/tmp/tmponv9oraf/job_working_directory/000/59/outputs/dataset_d487f4c9-6c6c-4357-9e42-71cd2d12ccec.dat" "Hap2" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282f916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap2" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cat/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmponv9oraf/files/3/0/9/dataset_309e1e4e-1c56-429a-aaac-c9f61e289311.dat' >> '/tmp/tmponv9oraf/job_working_directory/000/60/outputs/dataset_487a2c19-5171-4159-8a6c-5caba9f061cb.dat' && cat '/tmp/tmponv9oraf/files/d/4/8/dataset_d487f4c9-6c6c-4357-9e42-71cd2d12ccec.dat' >> '/tmp/tmponv9oraf/job_working_directory/000/60/outputs/dataset_487a2c19-5171-4159-8a6c-5caba9f061cb.dat' && exit 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282f916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | queries | ` [{"__index__": 0, "inputs2": {"values": [{"id": 105, "src": "hda"}]}}] ` |

           </details>

      - **Step 8: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmponv9oraf/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmponv9oraf/files/4/8/7/dataset_487a2c19-5171-4159-8a6c-5caba9f061cb.dat' 'c8,c5,c6' T '/tmp/tmponv9oraf/job_working_directory/000/61/outputs/dataset_4d5d1fc0-1da4-48a9-89a7-678f68b75595.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282f916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c5,c6" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 9: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmponv9oraf/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmponv9oraf/files/4/8/7/dataset_487a2c19-5171-4159-8a6c-5caba9f061cb.dat' 'c8,c4,c7' T '/tmp/tmponv9oraf/job_working_directory/000/62/outputs/dataset_172d982b-1e97-4407-b0d2-0181f7f5ddd9.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282f916811efb94feb2535e86d06" ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c4,c7" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 10: Nx Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmponv9oraf/job_working_directory/000/63/configs/tmp4vrc4yxi' && Rscript '/tmp/tmponv9oraf/job_working_directory/000/63/configs/tmp4vrc4yxi'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmponv9oraf/files/4/d/5/dataset_4d5d1fc0-1da4-48a9-89a7-678f68b75595.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmponv9oraf/job_working_directory/000/63/outputs/dataset_5d0ad8fe-5fa5-4fc9-b498-695b4143c1b2.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282f916811efb94feb2535e86d06" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "x" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Nx (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>
       </details>

 - **Step 43: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmponv9oraf/files/5/5/4/dataset_554b2a15-fcbe-4f0f-b1b1-f48f8e81fb3e.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-10-23 18:19:27 ERROR:   Something went wrong. Results not recorded.
           2024-10-23 18:19:27 ERROR:   BUSCO analysis failed!
           2024-10-23 18:19:27 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-10-23 18:08:29 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 10/23/2024 18:08:29 *****
           2024-10-23 18:08:29 INFO:    Configuring BUSCO with local environment
           2024-10-23 18:08:29 INFO:    Running genome mode
           2024-10-23 18:08:31 INFO:    Input file is /tmp/tmponv9oraf/files/5/5/4/dataset_554b2a15-fcbe-4f0f-b1b1-f48f8e81fb3e.dat
           2024-10-23 18:08:31 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:08:31 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:08:31 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-10-23 18:08:31 INFO:    Running 1 job(s) on bbtools, starting at 10/23/2024 18:08:31
           2024-10-23 18:08:33 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-10-23 18:08:33 INFO:    Running 1 job(s) on miniprot_index, starting at 10/23/2024 18:08:33
           2024-10-23 18:08:34 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-10-23 18:08:34 INFO:    Running 1 job(s) on miniprot_align, starting at 10/23/2024 18:08:34
           2024-10-23 18:18:47 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-10-23 18:18:50 INFO:    ***** Run HMMER on gene sequences *****
           2024-10-23 18:18:51 INFO:    Running 395 job(s) on hmmsearch, starting at 10/23/2024 18:18:51
           2024-10-23 18:18:56 INFO:    [hmmsearch] 40 of 395 task(s) completed
           2024-10-23 18:19:00 INFO:    [hmmsearch] 79 of 395 task(s) completed
           2024-10-23 18:19:04 INFO:    [hmmsearch] 119 of 395 task(s) completed
           2024-10-23 18:19:07 INFO:    [hmmsearch] 158 of 395 task(s) completed
           2024-10-23 18:19:10 INFO:    [hmmsearch] 198 of 395 task(s) completed
           2024-10-23 18:19:13 INFO:    [hmmsearch] 237 of 395 task(s) completed
           2024-10-23 18:19:17 INFO:    [hmmsearch] 277 of 395 task(s) completed
           2024-10-23 18:19:20 INFO:    [hmmsearch] 316 of 395 task(s) completed
           2024-10-23 18:19:23 INFO:    [hmmsearch] 356 of 395 task(s) completed
           2024-10-23 18:19:27 INFO:    [hmmsearch] 395 of 395 task(s) completed
           2024-10-23 18:19:27 INFO:    21 exons in total
           2024-10-23 18:19:27 WARNING: 1 of 16 Complete matches (6.2%) contain internal stop codons in Miniprot gene predictions

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 44: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy4**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           mkdir -p output_files && mkdir -p read-db.meryl && tar -zxf /tmp/tmponv9oraf/files/7/d/3/dataset_7d36a5a8-58fc-420e-83dc-82717dd4128a.dat -C read-db.meryl --strip-components=1 && ln -s '/tmp/tmponv9oraf/files/6/8/e/dataset_68e86ebd-bbc2-4e5b-bab7-413a5dfd47a5.dat' assembly_01.fasta && ln -s '/tmp/tmponv9oraf/files/5/5/4/dataset_554b2a15-fcbe-4f0f-b1b1-f48f8e81fb3e.dat' assembly_02.fasta && merqury.sh read-db.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmponv9oraf/job_working_directory/000/44/outputs/dataset_51f61b91-5b02-47e8-a1b7-9fe8921caba3.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | label | ` "output_merqury" ` |
             | mode | ` {"__current_case__": 0, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 49, "src": "hda"}]}, "assembly_02": {"values": [{"id": 48, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 5, "src": "hda"}]}, "options": "default"} ` |
             | output\_add\_headers | ` true ` |
             | output\_selector | ` ["qv", "plots", "stats", "log", "hist"] ` |

      </details>

 - **Step 45: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmponv9oraf/files/6/8/e/dataset_68e86ebd-bbc2-4e5b-bab7-413a5dfd47a5.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-10-23 18:25:40 ERROR:   Something went wrong. Results not recorded.
           2024-10-23 18:25:40 ERROR:   BUSCO analysis failed!
           2024-10-23 18:25:40 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-10-23 18:08:29 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 10/23/2024 18:08:29 *****
           2024-10-23 18:08:29 INFO:    Configuring BUSCO with local environment
           2024-10-23 18:08:29 INFO:    Running genome mode
           2024-10-23 18:08:31 INFO:    Input file is /tmp/tmponv9oraf/files/6/8/e/dataset_68e86ebd-bbc2-4e5b-bab7-413a5dfd47a5.dat
           2024-10-23 18:08:31 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:08:31 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:08:31 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-10-23 18:08:31 INFO:    Running 1 job(s) on bbtools, starting at 10/23/2024 18:08:31
           2024-10-23 18:08:33 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-10-23 18:08:33 INFO:    Running 1 job(s) on miniprot_index, starting at 10/23/2024 18:08:33
           2024-10-23 18:08:34 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-10-23 18:08:34 INFO:    Running 1 job(s) on miniprot_align, starting at 10/23/2024 18:08:34
           2024-10-23 18:25:02 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-10-23 18:25:09 INFO:    ***** Run HMMER on gene sequences *****
           2024-10-23 18:25:09 INFO:    Running 584 job(s) on hmmsearch, starting at 10/23/2024 18:25:09
           2024-10-23 18:25:14 INFO:    [hmmsearch] 59 of 584 task(s) completed
           2024-10-23 18:25:17 INFO:    [hmmsearch] 117 of 584 task(s) completed
           2024-10-23 18:25:20 INFO:    [hmmsearch] 176 of 584 task(s) completed
           2024-10-23 18:25:23 INFO:    [hmmsearch] 234 of 584 task(s) completed
           2024-10-23 18:25:26 INFO:    [hmmsearch] 292 of 584 task(s) completed
           2024-10-23 18:25:29 INFO:    [hmmsearch] 351 of 584 task(s) completed
           2024-10-23 18:25:32 INFO:    [hmmsearch] 409 of 584 task(s) completed
           2024-10-23 18:25:34 INFO:    [hmmsearch] 468 of 584 task(s) completed
           2024-10-23 18:25:37 INFO:    [hmmsearch] 526 of 584 task(s) completed
           2024-10-23 18:25:39 INFO:    [hmmsearch] 584 of 584 task(s) completed
           2024-10-23 18:25:40 INFO:    42 exons in total
           2024-10-23 18:25:40 WARNING: 2 of 33 Complete matches (6.1%) contain internal stop codons in Miniprot gene predictions
           2024-10-23 18:25:40 WARNING: BUSCO gene predictions from Miniprot have low average identity (0.4399999976158142). You may want to repeat the analysis using the Metaeuk pipeline.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 46: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cut\_tool/9.3+galaxy2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cut --complement -f '3' '/tmp/tmponv9oraf/files/e/d/f/dataset_edff8679-31f2-4a35-8ffd-dd62815913f0.dat' > '/tmp/tmponv9oraf/job_working_directory/000/46/outputs/dataset_9d63d291-afed-48a2-813c-51f0b79eb82a.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | complement | ` "--complement" ` |
             | cut\_type\_options | ` {"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""} ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 47: output_merqury.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 48: output_merqury.spectra-asm.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 49: merqury_qv**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | input | ` {"values": [{"id": 6, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 50: output_merqury.assembly_01.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 6: Database for Busco Lineage**:

    * step_state: scheduled

 - **Step 51: merqury_stats**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | input | ` {"values": [{"id": 8, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 52: output_merqury.assembly_02.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 53: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_find\_and\_replace/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmponv9oraf/job_working_directory/000/47/outputs/dataset_a065408d-abd5-4f3d-8cdc-82825b80a498.dat' -g     '#' 'Number of' '/tmp/tmponv9oraf/files/9/d/6/dataset_9d63d291-afed-48a2-813c-51f0b79eb82a.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "824d282c916811efb94feb2535e86d06" ` |
             | chromInfo | ` "/tmp/tmponv9oraf/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | find\_and\_replace | ` [{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}] ` |

      </details>

 - **Step 7: Lineage**:

    * step_state: scheduled

 - **Step 8: Name for Haplotype 1**:

    * step_state: scheduled

 - **Step 9: Name for Haplotype 2**:

    * step_state: scheduled

 - **Step 10: Bits for bloom filter**:

    * step_state: scheduled

  </details>
  • Other invocation details - **history_id** * dfec113d6e7584bf - **history_state** * ok - **invocation_id** * dfec113d6e7584bf - **invocation_state** * scheduled - **workflow_id** * 046ef01dff275b15

github-actions[bot] commented 6 days ago

Test Results (powered by Planemo)

Test Summary

Test State Count
Total 1
Passed 0
Error 0
Failure 1
Skipped 0
Failed Tests *
❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0
**Problems**: * ``` Output with path /tmp/tmp4ivypbm4/Hifiasm HiC hap1__53345d73-99fb-4de8-a253-c625af0a8c35 different than expected Expected 168+-0 lines in the output found 144 ``` * ``` Output with path /tmp/tmpp6bjmnk7/usable hap1 gfa__a9e0f869-2d86-437b-a2d7-ed684af69247 different than expected Expected 173+-0 lines in the output found 145 ``` #### Workflow invocation details * Invocation Messages *
Steps - **Step 1: Pacbio Reads Collection**: * step_state: scheduled - **Step 2: HiC forward reads**: * step_state: scheduled - **Step 11: SAK input file**: * step_state: scheduled - **Step 12: Homozygous Read Coverage**: * step_state: scheduled - **Step 13: Genomescope Model Parameters**: * step_state: scheduled - **Step 14: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1**: * step_state: scheduled *
Jobs - **Job 1:** * Job state is ok **Command Line:** * ```console ln -f -s '/tmp/tmpowe4nae5/files/f/4/2/dataset_f425b17e-a966-431b-a43f-047e09265e3c.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' && cutadapt -j=${GALAXY_SLOTS:-4} -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT' -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT' --error-rate=0.1 --times=1 --overlap=35 --action=trim --rc --discard-trimmed --minimum-length=1 --json=stats.json -o 'out1.fq.gz' 'yeast_reads_sub1_fastq_gz.fq.gz' > report.txt ``` **Exit Code:** * ```console 0 ``` **Traceback:** * ```console ``` **Job Parameters:** * | Job parameter | Parameter value | | ------------- | --------------- | | \_\_input\_ext | ` "input" ` | | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` | | adapter\_options | ` {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"} ` | | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` | | dbkey | ` "?" ` | | filter\_options | ` {"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"} ` | | library | ` {"__current_case__": 0, "input_1": {"values": [{"id": 1, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"} ` | | other\_trimming\_options | ` {"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false} ` | | output\_selector | ` ["report", "json_stats"] ` | | read\_mod\_options | ` {"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false} ` | 
 - **Step 15: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_grep\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpowe4nae5/files/c/b/a/dataset_cbae9afa-a0b5-4574-a663-cf12472dd5ca.dat' > '/tmp/tmpowe4nae5/job_working_directory/000/8/outputs/dataset_c33d2268-9450-4bca-8d73-bccd9ec5e94f.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | case\_sensitive | ` "-i" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | color | ` "NOCOLOR" ` |
             | dbkey | ` "?" ` |
             | invert | ` "" ` |
             | lines\_after | ` "0" ` |
             | lines\_before | ` "0" ` |
             | regex\_type | ` "-G" ` |
             | url\_paste | ` "Haploid" ` |

      </details>

 - **Step 16: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmpowe4nae5/job_working_directory/000/9/configs/tmpwgt3kltt' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpowe4nae5/files/8/3/7/dataset_8376cb97-4f2c-4d41-94ee-ddbc1e1cd928.dat' '/tmp/tmpowe4nae5/job_working_directory/000/9/outputs/dataset_abee4314-77ad-4905-a1a2-926dc9afbdcc.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           c3*2
           Computing 1 new columns with instructions ['c3*2;;']
           Computed new column values for 100.00% of 1 lines written.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | avoid\_scientific\_notation | ` false ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
             | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"} ` |

      </details>

 - **Step 17: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpowe4nae5/files/7/2/6/dataset_7265f2ba-2c5b-4fd0-9d4d-dfa299df270b.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console

           /// MultiQC 🔍 v1.24.1

                version_check | MultiQC Version v1.25.1 now available!
                  file_search | Search path: /tmp/tmpowe4nae5/job_working_directory/000/10/working/multiqc_WDir

                     cutadapt | Found 1 reports

                write_results | Data        : report_data
                write_results | Report      : report.html
                      multiqc | MultiQC complete

           ```
        **Standard Output:**

         * ```console
           total 72
           -rw-r--r-- 1 1001 127    93 Oct 23 18:04 cutadapt_filtered_reads_plot.txt
           -rw-r--r-- 1 1001 127    66 Oct 23 18:04 cutadapt_trimmed_sequences_plot_default_Counts.txt
           -rw-r--r-- 1 1001 127    70 Oct 23 18:04 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
           -rw-r--r-- 1 1001 127   124 Oct 23 18:04 multiqc_citations.txt
           -rw-r--r-- 1 1001 127   222 Oct 23 18:04 multiqc_cutadapt.txt
           -rw-r--r-- 1 1001 127 39114 Oct 23 18:04 multiqc_data.json
           -rw-r--r-- 1 1001 127   105 Oct 23 18:04 multiqc_general_stats.txt
           -rw-r--r-- 1 1001 127    29 Oct 23 18:04 multiqc_software_versions.txt
           -rw-r--r-- 1 1001 127   194 Oct 23 18:04 multiqc_sources.txt

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | comment | ` "" ` |
             | dbkey | ` "?" ` |
             | export | ` false ` |
             | flat | ` false ` |
             | results | ` [{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 3, "src": "hdca"}]}, "software": "cutadapt"}}] ` |
             | saveLog | ` "false" ` |
             | title | ` "" ` |

      </details>

 - **Step 18: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_replace\_in\_line/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmpowe4nae5/files/c/3/3/dataset_c33d2268-9450-4bca-8d73-bccd9ec5e94f.dat' > '/tmp/tmpowe4nae5/job_working_directory/000/11/outputs/dataset_34e54b08-f647-4cc3-9f37-e5a6533b6ed8.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | replacements | ` [{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}] ` |

      </details>

 - **Step 19: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmpowe4nae5/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpowe4nae5/files/a/b/e/dataset_abee4314-77ad-4905-a1a2-926dc9afbdcc.dat' 'c7' T '/tmp/tmpowe4nae5/job_working_directory/000/12/outputs/dataset_bd3cc61c-11f1-4100-8fcf-74bf1e786570.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c7" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 20: Convert characters1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python /tmp/tmpowe4nae5/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmpowe4nae5/files/3/4/e/dataset_34e54b08-f647-4cc3-9f37-e5a6533b6ed8.dat s /tmp/tmpowe4nae5/job_working_directory/000/13/outputs/dataset_221cafd2-e486-40b7-bd75-b1fc6b29b2a0.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "txt" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | condense | ` true ` |
             | convert\_from | ` "s" ` |
             | dbkey | ` "?" ` |
             | strip | ` true ` |

      </details>

 - **Step 3: HiC reverse reads**:

    * step_state: scheduled

 - **Step 21: Estimated homozygous read coverage**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 22: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmpowe4nae5/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpowe4nae5/files/2/2/1/dataset_221cafd2-e486-40b7-bd75-b1fc6b29b2a0.dat' 'c3' T '/tmp/tmpowe4nae5/job_working_directory/000/15/outputs/dataset_1031eaf3-6371-4c64-9426-022b678c3f79.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c3" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 23: Homozygous read coverage for Hifiasm**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | style\_cond | ` {"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}} ` |

      </details>

 - **Step 24: Estimated genome size**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 25: toolshed.g2.bx.psu.edu/repos/bgruening/hifiasm/hifiasm/0.19.9+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmpowe4nae5/files/7/e/6/dataset_7e684e21-e616-40a5-b950-d0cc89a873ef.dat' input_0.fastq.gz &&  mkdir HiCF HiCR && ln -s '/tmp/tmpowe4nae5/files/f/6/f/dataset_f6ffc14d-c86c-4a28-9967-ec25e364f847.dat' ./HiCF/input_0.fastqsanger.gz &&  ln -s '/tmp/tmpowe4nae5/files/8/0/9/dataset_80972b60-86e6-4490-bc12-d7b6f59ce4c3.dat' ./HiCR/input_0.fastqsanger.gz &&  hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21  --h1 './HiCF/input_0.fastqsanger.gz' --h2 './HiCR/input_0.fastqsanger.gz' --l-msjoin 500000   --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "fastq.gz" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | advanced\_options | ` {"__current_case__": 0, "advanced_selector": "blank"} ` |
             | assembly\_options | ` {"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"} ` |
             | bins\_out | ` false ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filter\_bits | ` "32" ` |
             | hic\_partition | ` {"__current_case__": 1, "f_perturb": null, "h1": {"values": [{"id": 1, "src": "hda"}]}, "h2": {"values": [{"id": 2, "src": "hda"}]}, "hic_partition_selector": "set", "l_msjoin": "500000", "n_perturb": null, "n_weight": null, "seed": null} ` |
             | log\_out | ` true ` |
             | mode | ` {"__current_case__": 0, "mode_selector": "standard", "reads": {"values": [{"id": 2, "src": "hdca"}]}} ` |
             | ont\_integration | ` {"__current_case__": 0, "ont_integration_selector": "blank"} ` |
             | purge\_options | ` {"__current_case__": 0, "purge_selector": "blank"} ` |
             | scaffolding\_options | ` {"__current_case__": 0, "scaffold_selector": "blank"} ` |

      </details>

 - **Step 26: Raw Unitig Image**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmpowe4nae5/files/d/2/9/dataset_d29706c7-f8e5-41e4-bb8f-5ce8b0cf8948.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | fontsize | ` None ` |
             | height | ` "2000" ` |
             | lengths | ` false ` |
             | names | ` false ` |
             | nodewidth | ` "25.0" ` |
             | output\_format | ` "png" ` |
             | width | ` None ` |

      </details>

 - **Step 27: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpowe4nae5/files/c/b/5/dataset_cb5adcd3-73e8-4a18-b942-9a355b47b4b9.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpowe4nae5/job_working_directory/000/20/outputs/dataset_20da2515-49b8-4ca0-8814-91cb4283f60f.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 28: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpowe4nae5/files/0/1/8/dataset_018bf6e1-e0f2-4b4e-ac70-8f8bec6ea9b9.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpowe4nae5/job_working_directory/000/21/outputs/dataset_c96160b7-c429-4a32-86ab-888f81c8cd53.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 29: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpowe4nae5/files/c/b/5/dataset_cb5adcd3-73e8-4a18-b942-9a355b47b4b9.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpowe4nae5/job_working_directory/000/22/outputs/dataset_fab77ef1-0a57-413b-ba14-6c01fe7f9d9d.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 30: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpowe4nae5/files/c/b/5/dataset_cb5adcd3-73e8-4a18-b942-9a355b47b4b9.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 4: Genomescope Summary**:

    * step_state: scheduled

 - **Step 31: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpowe4nae5/files/0/1/8/dataset_018bf6e1-e0f2-4b4e-ac70-8f8bec6ea9b9.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpowe4nae5/job_working_directory/000/24/outputs/dataset_762ae473-85c6-4fd6-9406-d59adbcfde86.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpowe4nae5/files/0/1/8/dataset_018bf6e1-e0f2-4b4e-ac70-8f8bec6ea9b9.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpowe4nae5/files/c/b/5/dataset_cb5adcd3-73e8-4a18-b942-9a355b47b4b9.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpowe4nae5/files/0/1/8/dataset_018bf6e1-e0f2-4b4e-ac70-8f8bec6ea9b9.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 35: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmpowe4nae5/job_working_directory/000/28/configs/tmp4ui8qexq' '/tmp/tmpowe4nae5/files/2/0/d/dataset_20da2515-49b8-4ca0-8814-91cb4283f60f.dat' > '/tmp/tmpowe4nae5/job_working_directory/000/28/outputs/dataset_5639eec5-b465-416e-926d-62a38686d20e.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap2\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmpowe4nae5/job_working_directory/000/29/configs/tmphctejg_l' '/tmp/tmpowe4nae5/files/c/9/6/dataset_c96160b7-c429-4a32-86ab-888f81c8cd53.dat' > '/tmp/tmpowe4nae5/job_working_directory/000/29/outputs/dataset_ae9e1a02-240f-47e0-82ba-3bb6783df42a.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap1\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 37: Data Prep Hap2**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmpowe4nae5/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpowe4nae5/files/f/a/b/dataset_fab77ef1-0a57-413b-ba14-6c01fe7f9d9d.dat' --output='/tmp/tmpowe4nae5/job_working_directory/000/30/outputs/dataset_a8f893a4-1224-4c20-a764-90ba3786dd5a.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73905916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmpowe4nae5/job_working_directory/000/31/configs/tmp8734ddms' '/tmp/tmpowe4nae5/files/a/8/f/dataset_a8f893a4-1224-4c20-a764-90ba3786dd5a.dat' > '/tmp/tmpowe4nae5/job_working_directory/000/31/outputs/dataset_36e80e24-5218-4a2c-ba00-e4b47b5308a4.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73905916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmpowe4nae5/files/3/6/e/dataset_36e80e24-5218-4a2c-ba00-e4b47b5308a4.dat > '/tmp/tmpowe4nae5/job_working_directory/000/32/outputs/dataset_fcad8f88-caee-4a50-a35d-59c5092ea6be.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73905916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpowe4nae5/files/3/6/e/dataset_36e80e24-5218-4a2c-ba00-e4b47b5308a4.dat" "/tmp/tmpowe4nae5/job_working_directory/000/33/outputs/dataset_50fb19f3-e97f-4a37-b47f-2d691e1a974a.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73905916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73905916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73905916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1008829", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpowe4nae5/job_working_directory/000/51/configs/tmp6i_ag0gy' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpowe4nae5/files/5/0/f/dataset_50fb19f3-e97f-4a37-b47f-2d691e1a974a.dat' '/tmp/tmpowe4nae5/job_working_directory/000/51/outputs/dataset_2f897b67-0422-42d2-958a-3516ce717082.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1008829
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1008829;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 35 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73905916911efa62213eabe8d117f" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1008829"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 38: Data Prep Hap1**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmpowe4nae5/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpowe4nae5/files/7/6/2/dataset_762ae473-85c6-4fd6-9406-d59adbcfde86.dat' --output='/tmp/tmpowe4nae5/job_working_directory/000/35/outputs/dataset_2cbbbaee-7d90-44a1-9ad9-cd98ba8c57ac.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73906916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmpowe4nae5/job_working_directory/000/36/configs/tmplln1ry79' '/tmp/tmpowe4nae5/files/2/c/b/dataset_2cbbbaee-7d90-44a1-9ad9-cd98ba8c57ac.dat' > '/tmp/tmpowe4nae5/job_working_directory/000/36/outputs/dataset_8134e587-8e29-417d-9ced-7542fb082c14.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73906916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmpowe4nae5/files/8/1/3/dataset_8134e587-8e29-417d-9ced-7542fb082c14.dat > '/tmp/tmpowe4nae5/job_working_directory/000/37/outputs/dataset_8401cbe2-cbdd-4c0c-95db-c8efb3f327a8.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73906916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpowe4nae5/files/8/1/3/dataset_8134e587-8e29-417d-9ced-7542fb082c14.dat" "/tmp/tmpowe4nae5/job_working_directory/000/38/outputs/dataset_918579e5-9198-4290-9cad-02a639d83b07.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73906916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73906916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73906916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1778748", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpowe4nae5/job_working_directory/000/50/configs/tmpoxghadlb' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpowe4nae5/files/9/1/8/dataset_918579e5-9198-4290-9cad-02a639d83b07.dat' '/tmp/tmpowe4nae5/job_working_directory/000/50/outputs/dataset_53b85e72-981f-469a-8f6d-6f7ec8f68d31.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1778748
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1778748;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 72 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73906916911efa62213eabe8d117f" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1778748"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 39: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmpowe4nae5/job_working_directory/000/40/configs/tmpo37wz0gj' '/tmp/tmpowe4nae5/files/f/0/0/dataset_f00a23e1-484e-40ac-bbeb-a5fa993cc647.dat' > '/tmp/tmpowe4nae5/job_working_directory/000/40/outputs/dataset_da4dff64-4af8-4a3a-9123-02bb3950f414.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 40: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmpowe4nae5/job_working_directory/000/41/configs/tmp9ruii_d3' '/tmp/tmpowe4nae5/files/b/f/c/dataset_bfc7b219-6cbb-4d8e-a6a2-0be45f293a3d.dat' > '/tmp/tmpowe4nae5/job_working_directory/000/41/outputs/dataset_53345d73-99fb-4de8-a253-c625af0a8c35.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 5: Meryl Database**:

    * step_state: scheduled

 - **Step 41: join1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/tmpowe4nae5/galaxy-dev/tools/filters/join.py' '/tmp/tmpowe4nae5/files/a/e/9/dataset_ae9e1a02-240f-47e0-82ba-3bb6783df42a.dat' '/tmp/tmpowe4nae5/files/5/6/3/dataset_5639eec5-b465-416e-926d-62a38686d20e.dat' 1 1 '/tmp/tmpowe4nae5/job_working_directory/000/42/outputs/dataset_65170cfb-1cce-4ca1-b5bd-b17b528bea9b.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmpowe4nae5/job_working_directory/000/42/configs/tmph91w4s6v
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | field1 | ` "1" ` |
             | field2 | ` "1" ` |
             | fill\_empty\_columns | ` {"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"} ` |
             | header | ` "" ` |
             | partial | ` "-p" ` |
             | unmatched | ` "-u" ` |

      </details>

 - **Step 42: Plot Data**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: Primary data**:

         * step_state: scheduled

      - **Step 2: Alternate data**:

         * step_state: scheduled

      - **Step 11: Size Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpowe4nae5/job_working_directory/000/58/configs/tmp1y3iovkw' && Rscript '/tmp/tmpowe4nae5/job_working_directory/000/58/configs/tmp1y3iovkw'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmpowe4nae5/files/9/b/7/dataset_9b75a2dc-bb33-4672-9474-0231492b7d9e.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmpowe4nae5/job_working_directory/000/58/outputs/dataset_e2fd2b7c-33a6-4ce6-b69f-6daabd3f88cf.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73907916911efa62213eabe8d117f" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "Scaffold number" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Cumulative Size (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>

      - **Step 3: Name of primary assembly**:

         * step_state: scheduled

      - **Step 4: Name of alternate assembly**:

         * step_state: scheduled

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpowe4nae5/files/5/3/b/dataset_53b85e72-981f-469a-8f6d-6f7ec8f68d31.dat" "/tmp/tmpowe4nae5/job_working_directory/000/52/outputs/dataset_57c89e40-c92b-41bd-9240-a27d5947a1e8.dat" "Hap1" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73907916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap1" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpowe4nae5/files/2/f/8/dataset_2f897b67-0422-42d2-958a-3516ce717082.dat" "/tmp/tmpowe4nae5/job_working_directory/000/53/outputs/dataset_c34aef87-46b4-4135-ba41-191b7ac72346.dat" "Hap2" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73907916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap2" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cat/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpowe4nae5/files/5/7/c/dataset_57c89e40-c92b-41bd-9240-a27d5947a1e8.dat' >> '/tmp/tmpowe4nae5/job_working_directory/000/54/outputs/dataset_3a027ba9-3a2d-4d03-96dc-e50a36546229.dat' && cat '/tmp/tmpowe4nae5/files/c/3/4/dataset_c34aef87-46b4-4135-ba41-191b7ac72346.dat' >> '/tmp/tmpowe4nae5/job_working_directory/000/54/outputs/dataset_3a027ba9-3a2d-4d03-96dc-e50a36546229.dat' && exit 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73907916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | queries | ` [{"__index__": 0, "inputs2": {"values": [{"id": 99, "src": "hda"}]}}] ` |

           </details>

      - **Step 8: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmpowe4nae5/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpowe4nae5/files/3/a/0/dataset_3a027ba9-3a2d-4d03-96dc-e50a36546229.dat' 'c8,c5,c6' T '/tmp/tmpowe4nae5/job_working_directory/000/55/outputs/dataset_6c0120b4-7147-4a50-bfdf-1ad78290f0a6.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73907916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c5,c6" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 9: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmpowe4nae5/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpowe4nae5/files/3/a/0/dataset_3a027ba9-3a2d-4d03-96dc-e50a36546229.dat' 'c8,c4,c7' T '/tmp/tmpowe4nae5/job_working_directory/000/56/outputs/dataset_9b75a2dc-bb33-4672-9474-0231492b7d9e.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73907916911efa62213eabe8d117f" ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c4,c7" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 10: Nx Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpowe4nae5/job_working_directory/000/57/configs/tmp8djas35v' && Rscript '/tmp/tmpowe4nae5/job_working_directory/000/57/configs/tmp8djas35v'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmpowe4nae5/files/6/c/0/dataset_6c0120b4-7147-4a50-bfdf-1ad78290f0a6.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmpowe4nae5/job_working_directory/000/57/outputs/dataset_b16cc136-2c91-4604-99bf-4d0e2867602f.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73907916911efa62213eabe8d117f" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "x" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Nx (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>
       </details>

 - **Step 43: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmpowe4nae5/files/d/a/4/dataset_da4dff64-4af8-4a3a-9123-02bb3950f414.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-10-23 18:22:30 ERROR:   Something went wrong. Results not recorded.
           2024-10-23 18:22:30 ERROR:   BUSCO analysis failed!
           2024-10-23 18:22:30 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-10-23 18:11:29 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 10/23/2024 18:11:29 *****
           2024-10-23 18:11:29 INFO:    Configuring BUSCO with local environment
           2024-10-23 18:11:29 INFO:    Running genome mode
           2024-10-23 18:11:33 INFO:    Input file is /tmp/tmpowe4nae5/files/d/a/4/dataset_da4dff64-4af8-4a3a-9123-02bb3950f414.dat
           2024-10-23 18:11:33 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:11:33 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:11:33 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-10-23 18:11:33 INFO:    Running 1 job(s) on bbtools, starting at 10/23/2024 18:11:33
           2024-10-23 18:11:35 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-10-23 18:11:35 INFO:    Running 1 job(s) on miniprot_index, starting at 10/23/2024 18:11:35
           2024-10-23 18:11:36 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-10-23 18:11:36 INFO:    Running 1 job(s) on miniprot_align, starting at 10/23/2024 18:11:36
           2024-10-23 18:21:38 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-10-23 18:21:41 INFO:    ***** Run HMMER on gene sequences *****
           2024-10-23 18:21:42 INFO:    Running 395 job(s) on hmmsearch, starting at 10/23/2024 18:21:42
           2024-10-23 18:21:48 INFO:    [hmmsearch] 40 of 395 task(s) completed
           2024-10-23 18:21:53 INFO:    [hmmsearch] 79 of 395 task(s) completed
           2024-10-23 18:21:58 INFO:    [hmmsearch] 119 of 395 task(s) completed
           2024-10-23 18:22:03 INFO:    [hmmsearch] 158 of 395 task(s) completed
           2024-10-23 18:22:07 INFO:    [hmmsearch] 198 of 395 task(s) completed
           2024-10-23 18:22:12 INFO:    [hmmsearch] 237 of 395 task(s) completed
           2024-10-23 18:22:16 INFO:    [hmmsearch] 277 of 395 task(s) completed
           2024-10-23 18:22:21 INFO:    [hmmsearch] 316 of 395 task(s) completed
           2024-10-23 18:22:25 INFO:    [hmmsearch] 356 of 395 task(s) completed
           2024-10-23 18:22:30 INFO:    [hmmsearch] 395 of 395 task(s) completed
           2024-10-23 18:22:30 INFO:    21 exons in total
           2024-10-23 18:22:30 WARNING: 1 of 16 Complete matches (6.2%) contain internal stop codons in Miniprot gene predictions

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 44: toolshed.g2.bx.psu.edu/repos/iuc/merqury/merqury/1.3+galaxy4**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           mkdir -p output_files && mkdir -p read-db.meryl && tar -zxf /tmp/tmpowe4nae5/files/2/5/0/dataset_2508507b-5ff6-49dc-a7d9-2a8bf1eb73f5.dat -C read-db.meryl --strip-components=1 && ln -s '/tmp/tmpowe4nae5/files/5/3/3/dataset_53345d73-99fb-4de8-a253-c625af0a8c35.dat' assembly_01.fasta && ln -s '/tmp/tmpowe4nae5/files/d/a/4/dataset_da4dff64-4af8-4a3a-9123-02bb3950f414.dat' assembly_02.fasta && merqury.sh read-db.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmpowe4nae5/job_working_directory/000/44/outputs/dataset_f946da28-a1c2-4af4-859f-900e9626115e.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | label | ` "output_merqury" ` |
             | mode | ` {"__current_case__": 0, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 49, "src": "hda"}]}, "assembly_02": {"values": [{"id": 48, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 5, "src": "hda"}]}, "options": "default"} ` |
             | output\_add\_headers | ` true ` |
             | output\_selector | ` ["qv", "plots", "stats", "log", "hist"] ` |

      </details>

 - **Step 45: toolshed.g2.bx.psu.edu/repos/iuc/busco/busco/5.7.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmpowe4nae5/files/5/3/3/dataset_53345d73-99fb-4de8-a253-c625af0a8c35.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-10-23 18:28:36 ERROR:   Something went wrong. Results not recorded.
           2024-10-23 18:28:36 ERROR:   BUSCO analysis failed!
           2024-10-23 18:28:36 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-10-23 18:11:29 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 10/23/2024 18:11:29 *****
           2024-10-23 18:11:29 INFO:    Configuring BUSCO with local environment
           2024-10-23 18:11:29 INFO:    Running genome mode
           2024-10-23 18:11:33 INFO:    Input file is /tmp/tmpowe4nae5/files/5/3/3/dataset_53345d73-99fb-4de8-a253-c625af0a8c35.dat
           2024-10-23 18:11:33 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:11:33 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:11:33 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-10-23 18:11:33 INFO:    Running 1 job(s) on bbtools, starting at 10/23/2024 18:11:33
           2024-10-23 18:11:35 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-10-23 18:11:35 INFO:    Running 1 job(s) on miniprot_index, starting at 10/23/2024 18:11:35
           2024-10-23 18:11:36 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-10-23 18:11:36 INFO:    Running 1 job(s) on miniprot_align, starting at 10/23/2024 18:11:36
           2024-10-23 18:27:51 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-10-23 18:27:56 INFO:    ***** Run HMMER on gene sequences *****
           2024-10-23 18:27:57 INFO:    Running 584 job(s) on hmmsearch, starting at 10/23/2024 18:27:57
           2024-10-23 18:28:03 INFO:    [hmmsearch] 59 of 584 task(s) completed
           2024-10-23 18:28:07 INFO:    [hmmsearch] 117 of 584 task(s) completed
           2024-10-23 18:28:10 INFO:    [hmmsearch] 176 of 584 task(s) completed
           2024-10-23 18:28:14 INFO:    [hmmsearch] 234 of 584 task(s) completed
           2024-10-23 18:28:17 INFO:    [hmmsearch] 292 of 584 task(s) completed
           2024-10-23 18:28:22 INFO:    [hmmsearch] 351 of 584 task(s) completed
           2024-10-23 18:28:25 INFO:    [hmmsearch] 409 of 584 task(s) completed
           2024-10-23 18:28:28 INFO:    [hmmsearch] 468 of 584 task(s) completed
           2024-10-23 18:28:32 INFO:    [hmmsearch] 526 of 584 task(s) completed
           2024-10-23 18:28:36 INFO:    [hmmsearch] 584 of 584 task(s) completed
           2024-10-23 18:28:36 INFO:    42 exons in total
           2024-10-23 18:28:36 WARNING: 2 of 33 Complete matches (6.1%) contain internal stop codons in Miniprot gene predictions
           2024-10-23 18:28:36 WARNING: BUSCO gene predictions from Miniprot have low average identity (0.4399999976158142). You may want to repeat the analysis using the Metaeuk pipeline.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 46: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cut\_tool/9.3+galaxy2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cut --complement -f '3' '/tmp/tmpowe4nae5/files/6/5/1/dataset_65170cfb-1cce-4ca1-b5bd-b17b528bea9b.dat' > '/tmp/tmpowe4nae5/job_working_directory/000/46/outputs/dataset_cf7103b0-e751-4dde-8ce6-1392466b0c48.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | complement | ` "--complement" ` |
             | cut\_type\_options | ` {"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""} ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 47: output_merqury.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 48: output_merqury.spectra-asm.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 49: merqury_qv**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | input | ` {"values": [{"id": 6, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 50: output_merqury.assembly_01.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 6: Database for Busco Lineage**:

    * step_state: scheduled

 - **Step 51: merqury_stats**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | input | ` {"values": [{"id": 8, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 52: output_merqury.assembly_02.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | input | ` {"values": [{"id": 7, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 53: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_find\_and\_replace/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmpowe4nae5/job_working_directory/000/47/outputs/dataset_178ce17c-b4ad-4211-bf61-a896bded12e4.dat' -g     '#' 'Number of' '/tmp/tmpowe4nae5/files/c/f/7/dataset_cf7103b0-e751-4dde-8ce6-1392466b0c48.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "0de73904916911efa62213eabe8d117f" ` |
             | chromInfo | ` "/tmp/tmpowe4nae5/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | find\_and\_replace | ` [{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}] ` |

      </details>

 - **Step 7: Lineage**:

    * step_state: scheduled

 - **Step 8: Name for Haplotype 1**:

    * step_state: scheduled

 - **Step 9: Name for Haplotype 2**:

    * step_state: scheduled

 - **Step 10: Bits for bloom filter**:

    * step_state: scheduled

  </details>
  • Other invocation details - **history_id** * 1ad7216bd15e7909 - **history_state** * ok - **invocation_id** * 1ad7216bd15e7909 - **invocation_state** * scheduled - **workflow_id** * c80e71409424b7d9

github-actions[bot] commented 6 days ago

Test Results (powered by Planemo)

Test Summary

Test State Count
Total 1
Passed 0
Error 0
Failure 1
Skipped 0
Failed Tests *
❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0
**Problems**: * ``` Output with path /tmp/tmpy77sby6b/Hifiasm HiC hap1__2d1464f3-16cd-46b5-90ab-c11095096b20 different than expected Expected 168+-0 lines in the output found 144 ``` * ``` Output with path /tmp/tmph_qu1sdt/usable hap1 gfa__0ab2c59f-f550-42c0-8b24-f73e9fea0f11 different than expected Expected 173+-0 lines in the output found 145 ``` #### Workflow invocation details * Invocation Messages *
Steps - **Step 1: Pacbio Reads Collection**: * step_state: scheduled - **Step 2: Collection of Hi-C Forward reads**: * step_state: scheduled - **Step 11: SAK input file**: * step_state: scheduled - **Step 12: Homozygous Read Coverage**: * step_state: scheduled - **Step 13: Genomescope Model Parameters**: * step_state: scheduled - **Step 14: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1**: * step_state: scheduled *
Jobs - **Job 1:** * Job state is ok **Command Line:** * ```console ln -f -s '/tmp/tmpmagt0j_q/files/8/6/5/dataset_865f9706-061e-404b-9788-19a6c952b585.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' && cutadapt -j=${GALAXY_SLOTS:-4} -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT' -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT' --error-rate=0.1 --times=1 --overlap=35 --action=trim --rc --discard-trimmed --minimum-length=1 --json=stats.json -o 'out1.fq.gz' 'yeast_reads_sub1_fastq_gz.fq.gz' > report.txt ``` **Exit Code:** * ```console 0 ``` **Traceback:** * ```console ``` **Job Parameters:** * | Job parameter | Parameter value | | ------------- | --------------- | | \_\_input\_ext | ` "input" ` | | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` | | adapter\_options | ` {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"} ` | | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` | | dbkey | ` "?" ` | | filter\_options | ` {"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"} ` | | library | ` {"__current_case__": 0, "input_1": {"values": [{"id": 3, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"} ` | | other\_trimming\_options | ` {"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false} ` | | output\_selector | ` ["report", "json_stats"] ` | | read\_mod\_options | ` {"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false} ` | 
 - **Step 15: \_\_SORTLIST\_\_**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | input | ` {"values": [{"id": 1, "src": "hdca"}]} ` |
             | sort\_type | ` {"__current_case__": 0, "sort_type": "alpha"} ` |

      </details>

 - **Step 16: \_\_SORTLIST\_\_**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | input | ` {"values": [{"id": 2, "src": "hdca"}]} ` |
             | sort\_type | ` {"__current_case__": 0, "sort_type": "alpha"} ` |

      </details>

 - **Step 17: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_grep\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpmagt0j_q/files/c/1/1/dataset_c11383e8-5173-43d9-982f-129f29176198.dat' > '/tmp/tmpmagt0j_q/job_working_directory/000/10/outputs/dataset_757fec99-0343-40cd-b647-97d0a1ac98a0.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | case\_sensitive | ` "-i" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | color | ` "NOCOLOR" ` |
             | dbkey | ` "?" ` |
             | invert | ` "" ` |
             | lines\_after | ` "0" ` |
             | lines\_before | ` "0" ` |
             | regex\_type | ` "-G" ` |
             | url\_paste | ` "Haploid" ` |

      </details>

 - **Step 18: pick\_value**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "data" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | style\_cond | ` {"__current_case__": 1, "pick_style": "first_or_default", "type_cond": {"__current_case__": 1, "default_value": "37", "param_type": "integer", "pick_from": [{"__index__": 0, "value": "32"}]}} ` |

      </details>

 - **Step 19: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmpmagt0j_q/job_working_directory/000/12/configs/tmp7yvtlhk2' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpmagt0j_q/files/9/0/6/dataset_9063f8cc-680e-402d-89a9-4711656d7ef5.dat' '/tmp/tmpmagt0j_q/job_working_directory/000/12/outputs/dataset_8328411a-f761-4af3-a79a-e585365deae8.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           c3*2
           Computing 1 new columns with instructions ['c3*2;;']
           Computed new column values for 100.00% of 1 lines written.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | avoid\_scientific\_notation | ` false ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
             | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"} ` |

      </details>

 - **Step 20: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpmagt0j_q/files/3/4/0/dataset_34096e0e-a1d6-4749-a5ee-b55dfd73475c.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console

           /// MultiQC 🔍 v1.24.1

                version_check | MultiQC Version v1.25.1 now available!
                  file_search | Search path: /tmp/tmpmagt0j_q/job_working_directory/000/13/working/multiqc_WDir

                     cutadapt | Found 1 reports

                write_results | Data        : report_data
                write_results | Report      : report.html
                      multiqc | MultiQC complete

           ```
        **Standard Output:**

         * ```console
           total 72
           -rw-r--r-- 1 1001 127    93 Oct 23 18:15 cutadapt_filtered_reads_plot.txt
           -rw-r--r-- 1 1001 127    66 Oct 23 18:15 cutadapt_trimmed_sequences_plot_default_Counts.txt
           -rw-r--r-- 1 1001 127    70 Oct 23 18:15 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
           -rw-r--r-- 1 1001 127   124 Oct 23 18:15 multiqc_citations.txt
           -rw-r--r-- 1 1001 127   222 Oct 23 18:15 multiqc_cutadapt.txt
           -rw-r--r-- 1 1001 127 39114 Oct 23 18:15 multiqc_data.json
           -rw-r--r-- 1 1001 127   105 Oct 23 18:15 multiqc_general_stats.txt
           -rw-r--r-- 1 1001 127    29 Oct 23 18:15 multiqc_software_versions.txt
           -rw-r--r-- 1 1001 127   194 Oct 23 18:15 multiqc_sources.txt

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | comment | ` "" ` |
             | dbkey | ` "?" ` |
             | export | ` false ` |
             | flat | ` false ` |
             | results | ` [{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "cutadapt"}}] ` |
             | saveLog | ` "false" ` |
             | title | ` "" ` |

      </details>

 - **Step 3: Collection of Hi-C Reverse reads**:

    * step_state: scheduled

 - **Step 21: Hi-C Forward Reads**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           (   cat "/tmp/tmpmagt0j_q/files/c/c/5/dataset_cc5cf74c-e78d-45f3-b1fb-f92d5645574a.dat" ;   ) > /tmp/tmpmagt0j_q/job_working_directory/000/14/outputs/dataset_2fb9e759-d2b8-4dc2-8ab2-30ec1e9060c5.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filename | ` {"__current_case__": 1, "add_name": false} ` |
             | one\_header | ` false ` |

      </details>

 - **Step 22: Hi-C Reverse Reads**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           (   cat "/tmp/tmpmagt0j_q/files/f/7/0/dataset_f701cc49-70fa-41e9-8329-7df8cc8ce548.dat" ;   ) > /tmp/tmpmagt0j_q/job_working_directory/000/15/outputs/dataset_4f1605b8-6e51-47c5-ad38-79ab1d48cbb4.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filename | ` {"__current_case__": 1, "add_name": false} ` |
             | one\_header | ` false ` |

      </details>

 - **Step 23: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_replace\_in\_line/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmpmagt0j_q/files/7/5/7/dataset_757fec99-0343-40cd-b647-97d0a1ac98a0.dat' > '/tmp/tmpmagt0j_q/job_working_directory/000/16/outputs/dataset_68034736-4ab8-429d-9a41-b24a29be1bc1.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | replacements | ` [{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}] ` |

      </details>

 - **Step 24: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmpmagt0j_q/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpmagt0j_q/files/8/3/2/dataset_8328411a-f761-4af3-a79a-e585365deae8.dat' 'c7' T '/tmp/tmpmagt0j_q/job_working_directory/000/17/outputs/dataset_0ef0a98d-e142-4b05-9952-bfa496f3670f.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c7" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 25: Convert characters1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python /tmp/tmpmagt0j_q/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmpmagt0j_q/files/6/8/0/dataset_68034736-4ab8-429d-9a41-b24a29be1bc1.dat s /tmp/tmpmagt0j_q/job_working_directory/000/18/outputs/dataset_e7d2618d-0038-454d-9837-5e0654564f7f.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "txt" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | condense | ` true ` |
             | convert\_from | ` "s" ` |
             | dbkey | ` "?" ` |
             | strip | ` true ` |

      </details>

 - **Step 26: Estimated homozygous read coverage**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 27: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmpmagt0j_q/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpmagt0j_q/files/e/7/d/dataset_e7d2618d-0038-454d-9837-5e0654564f7f.dat' 'c3' T '/tmp/tmpmagt0j_q/job_working_directory/000/20/outputs/dataset_3b3921eb-dbe1-40ed-ad3e-7007b7a60cb6.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c3" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 28: Homozygous read coverage for Hifiasm**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | style\_cond | ` {"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}} ` |

      </details>

 - **Step 29: Estimated genome size**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 30: Hifiasm**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmpmagt0j_q/files/0/7/c/dataset_07ccb03f-60be-4039-b7ef-b95ae735256b.dat' input_0.fastq.gz &&  mkdir HiCF HiCR && ln -s '/tmp/tmpmagt0j_q/files/2/f/b/dataset_2fb9e759-d2b8-4dc2-8ab2-30ec1e9060c5.dat' ./HiCF/input_0.fastqsanger.gz &&  ln -s '/tmp/tmpmagt0j_q/files/4/f/1/dataset_4f1605b8-6e51-47c5-ad38-79ab1d48cbb4.dat' ./HiCR/input_0.fastqsanger.gz &&  hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21  --h1 './HiCF/input_0.fastqsanger.gz' --h2 './HiCR/input_0.fastqsanger.gz' --l-msjoin 500000   --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "fastq.gz" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | advanced\_options | ` {"__current_case__": 0, "advanced_selector": "blank"} ` |
             | assembly\_options | ` {"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"} ` |
             | bins\_out | ` false ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filter\_bits | ` "32" ` |
             | hic\_partition | ` {"__current_case__": 1, "f_perturb": null, "h1": {"values": [{"id": 17, "src": "hda"}]}, "h2": {"values": [{"id": 18, "src": "hda"}]}, "hic_partition_selector": "set", "l_msjoin": "500000", "n_perturb": null, "n_weight": null, "seed": null} ` |
             | log\_out | ` true ` |
             | mode | ` {"__current_case__": 0, "mode_selector": "standard", "reads": {"values": [{"id": 4, "src": "hdca"}]}} ` |
             | ont\_integration | ` {"__current_case__": 0, "ont_integration_selector": "blank"} ` |
             | purge\_options | ` {"__current_case__": 0, "purge_selector": "blank"} ` |
             | scaffolding\_options | ` {"__current_case__": 0, "scaffold_selector": "blank"} ` |

      </details>

 - **Step 4: Genomescope Summary**:

    * step_state: scheduled

 - **Step 31: Raw Unitig Image**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmpmagt0j_q/files/8/d/9/dataset_8d974f95-b561-4766-8efd-597c8848fdd1.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | fontsize | ` None ` |
             | height | ` "2000" ` |
             | lengths | ` false ` |
             | names | ` false ` |
             | nodewidth | ` "25.0" ` |
             | output\_format | ` "png" ` |
             | width | ` None ` |

      </details>

 - **Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpmagt0j_q/files/c/2/c/dataset_c2c7144a-2dc5-4969-80b8-4f0b26a66bdb.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpmagt0j_q/job_working_directory/000/46/outputs/dataset_307b63e1-accc-4ac4-8d89-0b6a8fe674e1.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpmagt0j_q/files/2/5/2/dataset_252607e4-0857-4ca5-9987-ff668bc38932.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpmagt0j_q/job_working_directory/000/47/outputs/dataset_44e764cb-9c50-4797-a133-0fe39db82dcc.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpmagt0j_q/files/c/2/c/dataset_c2c7144a-2dc5-4969-80b8-4f0b26a66bdb.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpmagt0j_q/job_working_directory/000/25/outputs/dataset_d5be5c9c-e212-4d8f-a5ef-641aea72df0d.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 35: gfastats gfa hap2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpmagt0j_q/files/c/2/c/dataset_c2c7144a-2dc5-4969-80b8-4f0b26a66bdb.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpmagt0j_q/files/2/5/2/dataset_252607e4-0857-4ca5-9987-ff668bc38932.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpmagt0j_q/job_working_directory/000/27/outputs/dataset_3b5e164d-f214-4c2e-b5c1-f6cb32d70101.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 37: gfastats gfa hap1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpmagt0j_q/files/2/5/2/dataset_252607e4-0857-4ca5-9987-ff668bc38932.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 38: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpmagt0j_q/files/c/2/c/dataset_c2c7144a-2dc5-4969-80b8-4f0b26a66bdb.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 39: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpmagt0j_q/files/2/5/2/dataset_252607e4-0857-4ca5-9987-ff668bc38932.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 40: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmpmagt0j_q/job_working_directory/000/48/configs/tmp_wq3ex1s' '/tmp/tmpmagt0j_q/files/3/0/7/dataset_307b63e1-accc-4ac4-8d89-0b6a8fe674e1.dat' > '/tmp/tmpmagt0j_q/job_working_directory/000/48/outputs/dataset_049e05cd-3f33-4115-a48c-9db9bae0ca3c.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap2\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 5: Meryl Database**:

    * step_state: scheduled

 - **Step 41: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmpmagt0j_q/job_working_directory/000/49/configs/tmpmthsvlyp' '/tmp/tmpmagt0j_q/files/4/4/e/dataset_44e764cb-9c50-4797-a133-0fe39db82dcc.dat' > '/tmp/tmpmagt0j_q/job_working_directory/000/49/outputs/dataset_36113f47-0762-4573-a4ce-19322b363a45.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap1\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 42: Data Prep Hap2**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmpmagt0j_q/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpmagt0j_q/files/d/5/b/dataset_d5be5c9c-e212-4d8f-a5ef-641aea72df0d.dat' --output='/tmp/tmpmagt0j_q/job_working_directory/000/31/outputs/dataset_08f64e5a-1cb0-4e0c-927f-10b51d67de71.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be7916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmpmagt0j_q/job_working_directory/000/32/configs/tmp2oqkka29' '/tmp/tmpmagt0j_q/files/0/8/f/dataset_08f64e5a-1cb0-4e0c-927f-10b51d67de71.dat' > '/tmp/tmpmagt0j_q/job_working_directory/000/32/outputs/dataset_97f4cd6e-49eb-4680-ac5d-4aa88c8a8690.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be7916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmpmagt0j_q/files/9/7/f/dataset_97f4cd6e-49eb-4680-ac5d-4aa88c8a8690.dat > '/tmp/tmpmagt0j_q/job_working_directory/000/33/outputs/dataset_01ec30c4-1310-45b7-a7c8-73fc4a386f50.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be7916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpmagt0j_q/files/9/7/f/dataset_97f4cd6e-49eb-4680-ac5d-4aa88c8a8690.dat" "/tmp/tmpmagt0j_q/job_working_directory/000/34/outputs/dataset_3dcf359f-6092-4c22-938a-b04de7ef1c26.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be7916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be7916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be7916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1008829", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpmagt0j_q/job_working_directory/000/61/configs/tmp_dl6uowu' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpmagt0j_q/files/3/d/c/dataset_3dcf359f-6092-4c22-938a-b04de7ef1c26.dat' '/tmp/tmpmagt0j_q/job_working_directory/000/61/outputs/dataset_431ec4d8-7884-4dd2-b75d-36b761c29802.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1008829
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1008829;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 35 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be7916a11efbfe1c5fd9aa31575" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1008829"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 43: Data Prep Hap1**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmpmagt0j_q/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpmagt0j_q/files/3/b/5/dataset_3b5e164d-f214-4c2e-b5c1-f6cb32d70101.dat' --output='/tmp/tmpmagt0j_q/job_working_directory/000/36/outputs/dataset_9c033ebb-af2b-4a96-a69e-5f1ac76424ef.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be8916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmpmagt0j_q/job_working_directory/000/37/configs/tmpt_jxxpi_' '/tmp/tmpmagt0j_q/files/9/c/0/dataset_9c033ebb-af2b-4a96-a69e-5f1ac76424ef.dat' > '/tmp/tmpmagt0j_q/job_working_directory/000/37/outputs/dataset_98c82d48-28ab-4f88-bc1e-8671ec3ce0f1.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be8916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmpmagt0j_q/files/9/8/c/dataset_98c82d48-28ab-4f88-bc1e-8671ec3ce0f1.dat > '/tmp/tmpmagt0j_q/job_working_directory/000/38/outputs/dataset_552baa3e-24dd-4c4d-a57a-2c6263ac9546.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be8916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpmagt0j_q/files/9/8/c/dataset_98c82d48-28ab-4f88-bc1e-8671ec3ce0f1.dat" "/tmp/tmpmagt0j_q/job_working_directory/000/39/outputs/dataset_eb3afb22-b0bc-404c-a110-c38fedb39b4e.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be8916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be8916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be8916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1778748", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpmagt0j_q/job_working_directory/000/62/configs/tmpfa3gs0bm' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpmagt0j_q/files/e/b/3/dataset_eb3afb22-b0bc-404c-a110-c38fedb39b4e.dat' '/tmp/tmpmagt0j_q/job_working_directory/000/62/outputs/dataset_1b14d75e-f669-4e65-bdd4-32b86ad30701.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1778748
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1778748;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 72 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be8916a11efbfe1c5fd9aa31575" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1778748"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 44: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmpmagt0j_q/job_working_directory/000/41/configs/tmpdqbv_fzn' '/tmp/tmpmagt0j_q/files/4/0/b/dataset_40be9cdc-6180-46f7-82de-d6f0e1732cf2.dat' > '/tmp/tmpmagt0j_q/job_working_directory/000/41/outputs/dataset_6896a6a0-ea00-4ea8-8250-459876a975d5.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 45: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmpmagt0j_q/job_working_directory/000/42/configs/tmpshq3m44g' '/tmp/tmpmagt0j_q/files/5/9/d/dataset_59d83470-b1c0-42b7-9891-a0c007914d97.dat' > '/tmp/tmpmagt0j_q/job_working_directory/000/42/outputs/dataset_2d1464f3-16cd-46b5-90ab-c11095096b20.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 46: join1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/tmpmagt0j_q/galaxy-dev/tools/filters/join.py' '/tmp/tmpmagt0j_q/files/3/6/1/dataset_36113f47-0762-4573-a4ce-19322b363a45.dat' '/tmp/tmpmagt0j_q/files/0/4/9/dataset_049e05cd-3f33-4115-a48c-9db9bae0ca3c.dat' 1 1 '/tmp/tmpmagt0j_q/job_working_directory/000/50/outputs/dataset_76d9b095-77ca-4544-b4b1-c40c4400e8d9.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmpmagt0j_q/job_working_directory/000/50/configs/tmpsxj7xmfc
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | field1 | ` "1" ` |
             | field2 | ` "1" ` |
             | fill\_empty\_columns | ` {"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"} ` |
             | header | ` "" ` |
             | partial | ` "-p" ` |
             | unmatched | ` "-u" ` |

      </details>

 - **Step 47: Plot Data**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: Primary data**:

         * step_state: scheduled

      - **Step 2: Alternate data**:

         * step_state: scheduled

      - **Step 11: Size Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpmagt0j_q/job_working_directory/000/69/configs/tmpr8d0hq4k' && Rscript '/tmp/tmpmagt0j_q/job_working_directory/000/69/configs/tmpr8d0hq4k'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmpmagt0j_q/files/1/8/c/dataset_18c104b7-bf0f-4d15-93b8-27586ac291d3.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmpmagt0j_q/job_working_directory/000/69/outputs/dataset_adcdf7e9-5c16-402b-b9d3-3aa5ed9c6b41.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be9916a11efbfe1c5fd9aa31575" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "Scaffold number" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Cumulative Size (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>

      - **Step 3: Name of primary assembly**:

         * step_state: scheduled

      - **Step 4: Name of alternate assembly**:

         * step_state: scheduled

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpmagt0j_q/files/1/b/1/dataset_1b14d75e-f669-4e65-bdd4-32b86ad30701.dat" "/tmp/tmpmagt0j_q/job_working_directory/000/63/outputs/dataset_82279f1d-bc5d-4e43-b1b0-c2d89124dc57.dat" "Hap1" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be9916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap1" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpmagt0j_q/files/4/3/1/dataset_431ec4d8-7884-4dd2-b75d-36b761c29802.dat" "/tmp/tmpmagt0j_q/job_working_directory/000/64/outputs/dataset_99e6ed90-2a47-4a82-9d9c-50fb2e6a3370.dat" "Hap2" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be9916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap2" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cat/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpmagt0j_q/files/8/2/2/dataset_82279f1d-bc5d-4e43-b1b0-c2d89124dc57.dat' >> '/tmp/tmpmagt0j_q/job_working_directory/000/65/outputs/dataset_48ac2bcd-d952-40fe-873c-72f4d92f853c.dat' && cat '/tmp/tmpmagt0j_q/files/9/9/e/dataset_99e6ed90-2a47-4a82-9d9c-50fb2e6a3370.dat' >> '/tmp/tmpmagt0j_q/job_working_directory/000/65/outputs/dataset_48ac2bcd-d952-40fe-873c-72f4d92f853c.dat' && exit 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be9916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | queries | ` [{"__index__": 0, "inputs2": {"values": [{"id": 110, "src": "hda"}]}}] ` |

           </details>

      - **Step 8: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmpmagt0j_q/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpmagt0j_q/files/4/8/a/dataset_48ac2bcd-d952-40fe-873c-72f4d92f853c.dat' 'c8,c5,c6' T '/tmp/tmpmagt0j_q/job_working_directory/000/66/outputs/dataset_79b0d58e-3142-46ca-a091-34c1755b3332.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be9916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c5,c6" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 9: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmpmagt0j_q/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpmagt0j_q/files/4/8/a/dataset_48ac2bcd-d952-40fe-873c-72f4d92f853c.dat' 'c8,c4,c7' T '/tmp/tmpmagt0j_q/job_working_directory/000/67/outputs/dataset_18c104b7-bf0f-4d15-93b8-27586ac291d3.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be9916a11efbfe1c5fd9aa31575" ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c4,c7" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 10: Nx Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpmagt0j_q/job_working_directory/000/68/configs/tmpfsk4cvik' && Rscript '/tmp/tmpmagt0j_q/job_working_directory/000/68/configs/tmpfsk4cvik'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmpmagt0j_q/files/7/9/b/dataset_79b0d58e-3142-46ca-a091-34c1755b3332.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmpmagt0j_q/job_working_directory/000/68/outputs/dataset_d45a4866-aa7b-4d55-a5d5-44d80b98d176.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be9916a11efbfe1c5fd9aa31575" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "x" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Nx (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>
       </details>

 - **Step 48: Busco Hap2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmpmagt0j_q/files/6/8/9/dataset_6896a6a0-ea00-4ea8-8250-459876a975d5.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-10-23 18:33:34 ERROR:   Something went wrong. Results not recorded.
           2024-10-23 18:33:34 ERROR:   BUSCO analysis failed!
           2024-10-23 18:33:34 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-10-23 18:22:35 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 10/23/2024 18:22:35 *****
           2024-10-23 18:22:35 INFO:    Configuring BUSCO with local environment
           2024-10-23 18:22:35 INFO:    Running genome mode
           2024-10-23 18:22:42 INFO:    Input file is /tmp/tmpmagt0j_q/files/6/8/9/dataset_6896a6a0-ea00-4ea8-8250-459876a975d5.dat
           2024-10-23 18:22:42 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:22:42 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:22:43 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-10-23 18:22:43 INFO:    Running 1 job(s) on bbtools, starting at 10/23/2024 18:22:43
           2024-10-23 18:22:44 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-10-23 18:22:44 INFO:    Running 1 job(s) on miniprot_index, starting at 10/23/2024 18:22:44
           2024-10-23 18:22:45 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-10-23 18:22:45 INFO:    Running 1 job(s) on miniprot_align, starting at 10/23/2024 18:22:45
           2024-10-23 18:32:50 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-10-23 18:32:53 INFO:    ***** Run HMMER on gene sequences *****
           2024-10-23 18:32:54 INFO:    Running 395 job(s) on hmmsearch, starting at 10/23/2024 18:32:54
           2024-10-23 18:32:59 INFO:    [hmmsearch] 40 of 395 task(s) completed
           2024-10-23 18:33:03 INFO:    [hmmsearch] 79 of 395 task(s) completed
           2024-10-23 18:33:07 INFO:    [hmmsearch] 119 of 395 task(s) completed
           2024-10-23 18:33:11 INFO:    [hmmsearch] 158 of 395 task(s) completed
           2024-10-23 18:33:15 INFO:    [hmmsearch] 198 of 395 task(s) completed
           2024-10-23 18:33:18 INFO:    [hmmsearch] 237 of 395 task(s) completed
           2024-10-23 18:33:22 INFO:    [hmmsearch] 277 of 395 task(s) completed
           2024-10-23 18:33:25 INFO:    [hmmsearch] 316 of 395 task(s) completed
           2024-10-23 18:33:30 INFO:    [hmmsearch] 356 of 395 task(s) completed
           2024-10-23 18:33:33 INFO:    [hmmsearch] 395 of 395 task(s) completed
           2024-10-23 18:33:33 INFO:    21 exons in total
           2024-10-23 18:33:34 WARNING: 1 of 16 Complete matches (6.2%) contain internal stop codons in Miniprot gene predictions

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 49: Merqury**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           mkdir -p output_files && mkdir -p read-db.meryl && tar -zxf /tmp/tmpmagt0j_q/files/0/b/b/dataset_0bb2d1bb-1d2c-444f-9cba-eb2aeaec103a.dat -C read-db.meryl --strip-components=1 && ln -s '/tmp/tmpmagt0j_q/files/2/d/1/dataset_2d1464f3-16cd-46b5-90ab-c11095096b20.dat' assembly_01.fasta && ln -s '/tmp/tmpmagt0j_q/files/6/8/9/dataset_6896a6a0-ea00-4ea8-8250-459876a975d5.dat' assembly_02.fasta && merqury.sh read-db.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmpmagt0j_q/job_working_directory/000/44/outputs/dataset_959d1a47-6fb7-4dd3-aa6e-a28c75d5e001.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | label | ` "output_merqury" ` |
             | mode | ` {"__current_case__": 0, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 50, "src": "hda"}]}, "assembly_02": {"values": [{"id": 49, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 5, "src": "hda"}]}, "options": "default"} ` |
             | output\_add\_headers | ` true ` |
             | output\_selector | ` ["qv", "plots", "stats", "log", "hist"] ` |

      </details>

 - **Step 50: Busco Hap1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmpmagt0j_q/files/2/d/1/dataset_2d1464f3-16cd-46b5-90ab-c11095096b20.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-10-23 18:39:39 ERROR:   Something went wrong. Results not recorded.
           2024-10-23 18:39:39 ERROR:   BUSCO analysis failed!
           2024-10-23 18:39:39 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-10-23 18:22:35 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 10/23/2024 18:22:35 *****
           2024-10-23 18:22:35 INFO:    Configuring BUSCO with local environment
           2024-10-23 18:22:35 INFO:    Running genome mode
           2024-10-23 18:22:42 INFO:    Input file is /tmp/tmpmagt0j_q/files/2/d/1/dataset_2d1464f3-16cd-46b5-90ab-c11095096b20.dat
           2024-10-23 18:22:42 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:22:42 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:22:43 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-10-23 18:22:43 INFO:    Running 1 job(s) on bbtools, starting at 10/23/2024 18:22:43
           2024-10-23 18:22:44 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-10-23 18:22:44 INFO:    Running 1 job(s) on miniprot_index, starting at 10/23/2024 18:22:44
           2024-10-23 18:22:45 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-10-23 18:22:45 INFO:    Running 1 job(s) on miniprot_align, starting at 10/23/2024 18:22:45
           2024-10-23 18:39:01 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-10-23 18:39:07 INFO:    ***** Run HMMER on gene sequences *****
           2024-10-23 18:39:07 INFO:    Running 584 job(s) on hmmsearch, starting at 10/23/2024 18:39:07
           2024-10-23 18:39:12 INFO:    [hmmsearch] 59 of 584 task(s) completed
           2024-10-23 18:39:16 INFO:    [hmmsearch] 117 of 584 task(s) completed
           2024-10-23 18:39:18 INFO:    [hmmsearch] 176 of 584 task(s) completed
           2024-10-23 18:39:21 INFO:    [hmmsearch] 234 of 584 task(s) completed
           2024-10-23 18:39:24 INFO:    [hmmsearch] 292 of 584 task(s) completed
           2024-10-23 18:39:28 INFO:    [hmmsearch] 351 of 584 task(s) completed
           2024-10-23 18:39:31 INFO:    [hmmsearch] 409 of 584 task(s) completed
           2024-10-23 18:39:33 INFO:    [hmmsearch] 468 of 584 task(s) completed
           2024-10-23 18:39:36 INFO:    [hmmsearch] 526 of 584 task(s) completed
           2024-10-23 18:39:39 INFO:    [hmmsearch] 584 of 584 task(s) completed
           2024-10-23 18:39:39 INFO:    42 exons in total
           2024-10-23 18:39:39 WARNING: 2 of 33 Complete matches (6.1%) contain internal stop codons in Miniprot gene predictions
           2024-10-23 18:39:39 WARNING: BUSCO gene predictions from Miniprot have low average identity (0.4399999976158142). You may want to repeat the analysis using the Metaeuk pipeline.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 6: Database for Busco Lineage**:

    * step_state: scheduled

 - **Step 51: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cut\_tool/9.3+galaxy2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cut --complement -f '3' '/tmp/tmpmagt0j_q/files/7/6/d/dataset_76d9b095-77ca-4544-b4b1-c40c4400e8d9.dat' > '/tmp/tmpmagt0j_q/job_working_directory/000/51/outputs/dataset_1ad7afc9-e7e4-4f7f-aabb-7312f61930c7.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | complement | ` "--complement" ` |
             | cut\_type\_options | ` {"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""} ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 52: output_merqury.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 53: output_merqury.spectra-asm.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 54: merqury_qv**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | input | ` {"values": [{"id": 10, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 55: output_merqury.assembly_01.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 56: merqury_stats**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | input | ` {"values": [{"id": 12, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 57: output_merqury.assembly_02.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 58: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_find\_and\_replace/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmpmagt0j_q/job_working_directory/000/52/outputs/dataset_fc003cd3-cf53-43a4-b85e-729678fe93a8.dat' -g     '#' 'Number of' '/tmp/tmpmagt0j_q/files/1/a/d/dataset_1ad7afc9-e7e4-4f7f-aabb-7312f61930c7.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "a3e97be6916a11efbfe1c5fd9aa31575" ` |
             | chromInfo | ` "/tmp/tmpmagt0j_q/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | find\_and\_replace | ` [{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}] ` |

      </details>

 - **Step 7: Lineage**:

    * step_state: scheduled

 - **Step 8: Name for Haplotype 1**:

    * step_state: scheduled

 - **Step 9: Name for Haplotype 2**:

    * step_state: scheduled

 - **Step 10: Bits for bloom filter**:

    * step_state: scheduled

  </details>
  • Other invocation details - **history_id** * e819cd6350063d6a - **history_state** * ok - **invocation_id** * e819cd6350063d6a - **invocation_state** * scheduled - **workflow_id** * b4a4b12a7cd6744b

github-actions[bot] commented 6 days ago

Test Results (powered by Planemo)

Test Summary

Test State Count
Total 1
Passed 0
Error 0
Failure 1
Skipped 0
Failed Tests *
❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0
**Problems**: * ``` Output with path /tmp/tmpgoarb5fz/Hifiasm HiC hap1__04888cdc-02cd-4858-92c6-bb8aa7319b31 different than expected Expected 168+-0 lines in the output found 144 ``` * ``` Output with path /tmp/tmpv9e9ozd_/usable hap1 gfa__2d61f41c-eed3-4521-a564-a1193239b4ff different than expected Expected 173+-0 lines in the output found 145 ``` #### Workflow invocation details * Invocation Messages *
Steps - **Step 1: Pacbio Reads Collection**: * step_state: scheduled - **Step 2: Collection of Hi-C Forward reads**: * step_state: scheduled - **Step 11: SAK input file**: * step_state: scheduled - **Step 12: Homozygous Read Coverage**: * step_state: scheduled - **Step 13: Genomescope Model Parameters**: * step_state: scheduled - **Step 14: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1**: * step_state: scheduled *
Jobs - **Job 1:** * Job state is ok **Command Line:** * ```console ln -f -s '/tmp/tmpw1httrqq/files/4/4/a/dataset_44a21aca-2454-4950-9a5f-2a0d36b2dbdb.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' && cutadapt -j=${GALAXY_SLOTS:-4} -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT' -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT' --error-rate=0.1 --times=1 --overlap=35 --action=trim --rc --discard-trimmed --minimum-length=1 --json=stats.json -o 'out1.fq.gz' 'yeast_reads_sub1_fastq_gz.fq.gz' > report.txt ``` **Exit Code:** * ```console 0 ``` **Traceback:** * ```console ``` **Job Parameters:** * | Job parameter | Parameter value | | ------------- | --------------- | | \_\_input\_ext | ` "input" ` | | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` | | adapter\_options | ` {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"} ` | | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` | | dbkey | ` "?" ` | | filter\_options | ` {"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"} ` | | library | ` {"__current_case__": 0, "input_1": {"values": [{"id": 3, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"} ` | | other\_trimming\_options | ` {"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false} ` | | output\_selector | ` ["report", "json_stats"] ` | | read\_mod\_options | ` {"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false} ` | 
 - **Step 15: \_\_SORTLIST\_\_**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | input | ` {"values": [{"id": 1, "src": "hdca"}]} ` |
             | sort\_type | ` {"__current_case__": 0, "sort_type": "alpha"} ` |

      </details>

 - **Step 16: \_\_SORTLIST\_\_**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | input | ` {"values": [{"id": 2, "src": "hdca"}]} ` |
             | sort\_type | ` {"__current_case__": 0, "sort_type": "alpha"} ` |

      </details>

 - **Step 17: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_grep\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpw1httrqq/files/d/5/9/dataset_d593d179-c261-47bb-a88b-e3ab5d6eae09.dat' > '/tmp/tmpw1httrqq/job_working_directory/000/10/outputs/dataset_b03eba83-5c5a-45d3-9fc0-7ab44453a466.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | case\_sensitive | ` "-i" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | color | ` "NOCOLOR" ` |
             | dbkey | ` "?" ` |
             | invert | ` "" ` |
             | lines\_after | ` "0" ` |
             | lines\_before | ` "0" ` |
             | regex\_type | ` "-G" ` |
             | url\_paste | ` "Haploid" ` |

      </details>

 - **Step 18: pick\_value**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "data" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | style\_cond | ` {"__current_case__": 1, "pick_style": "first_or_default", "type_cond": {"__current_case__": 1, "default_value": "37", "param_type": "integer", "pick_from": [{"__index__": 0, "value": "32"}]}} ` |

      </details>

 - **Step 19: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmpw1httrqq/job_working_directory/000/12/configs/tmpw0vgzn3p' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpw1httrqq/files/5/2/d/dataset_52d7aec3-1c88-4fbf-bf20-013386bb4ce1.dat' '/tmp/tmpw1httrqq/job_working_directory/000/12/outputs/dataset_526d9e63-4e9a-4327-9333-511a72b7252a.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           c3*2
           Computing 1 new columns with instructions ['c3*2;;']
           Computed new column values for 100.00% of 1 lines written.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | avoid\_scientific\_notation | ` false ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
             | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"} ` |

      </details>

 - **Step 20: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpw1httrqq/files/c/1/d/dataset_c1d4d4ac-c8fd-4f95-b649-87f362cd0479.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console

           /// MultiQC 🔍 v1.24.1

                version_check | MultiQC Version v1.25.1 now available!
                  file_search | Search path: /tmp/tmpw1httrqq/job_working_directory/000/13/working/multiqc_WDir

                     cutadapt | Found 1 reports

                write_results | Data        : report_data
                write_results | Report      : report.html
                      multiqc | MultiQC complete

           ```
        **Standard Output:**

         * ```console
           total 72
           -rw-r--r-- 1 1001 127    93 Oct 23 18:21 cutadapt_filtered_reads_plot.txt
           -rw-r--r-- 1 1001 127    66 Oct 23 18:21 cutadapt_trimmed_sequences_plot_default_Counts.txt
           -rw-r--r-- 1 1001 127    70 Oct 23 18:21 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
           -rw-r--r-- 1 1001 127   124 Oct 23 18:21 multiqc_citations.txt
           -rw-r--r-- 1 1001 127   222 Oct 23 18:21 multiqc_cutadapt.txt
           -rw-r--r-- 1 1001 127 39114 Oct 23 18:21 multiqc_data.json
           -rw-r--r-- 1 1001 127   105 Oct 23 18:21 multiqc_general_stats.txt
           -rw-r--r-- 1 1001 127    29 Oct 23 18:21 multiqc_software_versions.txt
           -rw-r--r-- 1 1001 127   194 Oct 23 18:21 multiqc_sources.txt

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | comment | ` "" ` |
             | dbkey | ` "?" ` |
             | export | ` false ` |
             | flat | ` false ` |
             | results | ` [{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "cutadapt"}}] ` |
             | saveLog | ` "false" ` |
             | title | ` "" ` |

      </details>

 - **Step 3: Collection of Hi-C Reverse reads**:

    * step_state: scheduled

 - **Step 21: Hi-C Forward Reads**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           (   cat "/tmp/tmpw1httrqq/files/9/e/b/dataset_9eb9667d-ab4d-4812-8971-929be351772a.dat" ;   ) > /tmp/tmpw1httrqq/job_working_directory/000/14/outputs/dataset_3d4dc86a-7a4b-4b62-b072-5d553965f8a0.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filename | ` {"__current_case__": 1, "add_name": false} ` |
             | one\_header | ` false ` |

      </details>

 - **Step 22: Hi-C Reverse Reads**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           (   cat "/tmp/tmpw1httrqq/files/6/b/2/dataset_6b23b00e-1c9c-4c09-9916-f1b446509dfb.dat" ;   ) > /tmp/tmpw1httrqq/job_working_directory/000/15/outputs/dataset_2d181593-ea84-4baf-891c-0bd003b52d7c.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filename | ` {"__current_case__": 1, "add_name": false} ` |
             | one\_header | ` false ` |

      </details>

 - **Step 23: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_replace\_in\_line/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmpw1httrqq/files/b/0/3/dataset_b03eba83-5c5a-45d3-9fc0-7ab44453a466.dat' > '/tmp/tmpw1httrqq/job_working_directory/000/16/outputs/dataset_7a37daf7-9eac-4dba-aa31-8575ea06ee38.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | replacements | ` [{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}] ` |

      </details>

 - **Step 24: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmpw1httrqq/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpw1httrqq/files/5/2/6/dataset_526d9e63-4e9a-4327-9333-511a72b7252a.dat' 'c7' T '/tmp/tmpw1httrqq/job_working_directory/000/17/outputs/dataset_e826e118-6fd8-49fa-8e2b-8a0c9f88ff89.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c7" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 25: Convert characters1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python /tmp/tmpw1httrqq/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmpw1httrqq/files/7/a/3/dataset_7a37daf7-9eac-4dba-aa31-8575ea06ee38.dat s /tmp/tmpw1httrqq/job_working_directory/000/18/outputs/dataset_08aad654-5b0f-4737-a158-9dd939964227.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "txt" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | condense | ` true ` |
             | convert\_from | ` "s" ` |
             | dbkey | ` "?" ` |
             | strip | ` true ` |

      </details>

 - **Step 26: Estimated homozygous read coverage**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 27: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmpw1httrqq/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpw1httrqq/files/0/8/a/dataset_08aad654-5b0f-4737-a158-9dd939964227.dat' 'c3' T '/tmp/tmpw1httrqq/job_working_directory/000/20/outputs/dataset_f7347001-9e48-435e-9513-ca0481326303.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c3" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 28: Homozygous read coverage for Hifiasm**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | style\_cond | ` {"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}} ` |

      </details>

 - **Step 29: Estimated genome size**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 30: Hifiasm**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmpw1httrqq/files/f/4/5/dataset_f45110f4-6f93-4e7c-b717-16dcb5ad6743.dat' input_0.fastq.gz &&  mkdir HiCF HiCR && ln -s '/tmp/tmpw1httrqq/files/3/d/4/dataset_3d4dc86a-7a4b-4b62-b072-5d553965f8a0.dat' ./HiCF/input_0.fastqsanger.gz &&  ln -s '/tmp/tmpw1httrqq/files/2/d/1/dataset_2d181593-ea84-4baf-891c-0bd003b52d7c.dat' ./HiCR/input_0.fastqsanger.gz &&  hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21  --h1 './HiCF/input_0.fastqsanger.gz' --h2 './HiCR/input_0.fastqsanger.gz' --l-msjoin 500000   --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "fastq.gz" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | advanced\_options | ` {"__current_case__": 0, "advanced_selector": "blank"} ` |
             | assembly\_options | ` {"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"} ` |
             | bins\_out | ` false ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filter\_bits | ` "32" ` |
             | hic\_partition | ` {"__current_case__": 1, "f_perturb": null, "h1": {"values": [{"id": 17, "src": "hda"}]}, "h2": {"values": [{"id": 18, "src": "hda"}]}, "hic_partition_selector": "set", "l_msjoin": "500000", "n_perturb": null, "n_weight": null, "seed": null} ` |
             | log\_out | ` true ` |
             | mode | ` {"__current_case__": 0, "mode_selector": "standard", "reads": {"values": [{"id": 4, "src": "hdca"}]}} ` |
             | ont\_integration | ` {"__current_case__": 0, "ont_integration_selector": "blank"} ` |
             | purge\_options | ` {"__current_case__": 0, "purge_selector": "blank"} ` |
             | scaffolding\_options | ` {"__current_case__": 0, "scaffold_selector": "blank"} ` |

      </details>

 - **Step 4: Genomescope Summary**:

    * step_state: scheduled

 - **Step 31: Raw Unitig Image**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmpw1httrqq/files/d/3/6/dataset_d3669e67-7da5-445e-866a-da4c98afd9dc.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | fontsize | ` None ` |
             | height | ` "2000" ` |
             | lengths | ` false ` |
             | names | ` false ` |
             | nodewidth | ` "25.0" ` |
             | output\_format | ` "png" ` |
             | width | ` None ` |

      </details>

 - **Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpw1httrqq/files/7/0/7/dataset_7077ebf4-396f-4b0d-ab9d-f540144f8a8f.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpw1httrqq/job_working_directory/000/46/outputs/dataset_70a24bfc-2bdb-4f9b-ae18-2cbf90c19b8d.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpw1httrqq/files/1/4/4/dataset_1443e21e-2d14-434b-af65-57b60b27bf18.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpw1httrqq/job_working_directory/000/47/outputs/dataset_87c4570b-6c5e-45c5-9e2c-d0354fee346e.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpw1httrqq/files/7/0/7/dataset_7077ebf4-396f-4b0d-ab9d-f540144f8a8f.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpw1httrqq/job_working_directory/000/25/outputs/dataset_8f129709-1079-420d-a59f-1f6981a1628c.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 35: gfastats gfa hap2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpw1httrqq/files/7/0/7/dataset_7077ebf4-396f-4b0d-ab9d-f540144f8a8f.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpw1httrqq/files/1/4/4/dataset_1443e21e-2d14-434b-af65-57b60b27bf18.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpw1httrqq/job_working_directory/000/27/outputs/dataset_0f642c5f-571a-416b-81fc-59998a4166cc.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 37: gfastats gfa hap1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpw1httrqq/files/1/4/4/dataset_1443e21e-2d14-434b-af65-57b60b27bf18.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 38: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpw1httrqq/files/7/0/7/dataset_7077ebf4-396f-4b0d-ab9d-f540144f8a8f.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 39: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpw1httrqq/files/1/4/4/dataset_1443e21e-2d14-434b-af65-57b60b27bf18.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 40: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmpw1httrqq/job_working_directory/000/48/configs/tmpoz9neryh' '/tmp/tmpw1httrqq/files/7/0/a/dataset_70a24bfc-2bdb-4f9b-ae18-2cbf90c19b8d.dat' > '/tmp/tmpw1httrqq/job_working_directory/000/48/outputs/dataset_a73bfdcf-e6aa-4af0-8cfd-50a403a113b0.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap2\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 5: Meryl Database**:

    * step_state: scheduled

 - **Step 41: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmpw1httrqq/job_working_directory/000/49/configs/tmp76_wo3tp' '/tmp/tmpw1httrqq/files/8/7/c/dataset_87c4570b-6c5e-45c5-9e2c-d0354fee346e.dat' > '/tmp/tmpw1httrqq/job_working_directory/000/49/outputs/dataset_c5c836e4-c4df-4bc4-8ade-fbce12d17263.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap1\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 42: Data Prep Hap2**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmpw1httrqq/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpw1httrqq/files/8/f/1/dataset_8f129709-1079-420d-a59f-1f6981a1628c.dat' --output='/tmp/tmpw1httrqq/job_working_directory/000/31/outputs/dataset_f0e22074-1b93-41ed-a1a0-9f3284f60c00.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36f916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmpw1httrqq/job_working_directory/000/32/configs/tmpo9znss7_' '/tmp/tmpw1httrqq/files/f/0/e/dataset_f0e22074-1b93-41ed-a1a0-9f3284f60c00.dat' > '/tmp/tmpw1httrqq/job_working_directory/000/32/outputs/dataset_583f2bb8-8cb6-45f5-b43b-cd4900ff2118.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36f916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmpw1httrqq/files/5/8/3/dataset_583f2bb8-8cb6-45f5-b43b-cd4900ff2118.dat > '/tmp/tmpw1httrqq/job_working_directory/000/33/outputs/dataset_834eee67-e04a-4922-9456-4e7025e50d13.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36f916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpw1httrqq/files/5/8/3/dataset_583f2bb8-8cb6-45f5-b43b-cd4900ff2118.dat" "/tmp/tmpw1httrqq/job_working_directory/000/34/outputs/dataset_5a1ec006-ba44-4ef7-aaa0-7b91677ffb69.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36f916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36f916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36f916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1008829", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpw1httrqq/job_working_directory/000/62/configs/tmp9llgkl1f' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpw1httrqq/files/5/a/1/dataset_5a1ec006-ba44-4ef7-aaa0-7b91677ffb69.dat' '/tmp/tmpw1httrqq/job_working_directory/000/62/outputs/dataset_66ab8a72-3c0f-40dc-bc0e-4fa1a6b7960d.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1008829
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1008829;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 35 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36f916b11ef956ea77344e9b50b" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1008829"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 43: Data Prep Hap1**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmpw1httrqq/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpw1httrqq/files/0/f/6/dataset_0f642c5f-571a-416b-81fc-59998a4166cc.dat' --output='/tmp/tmpw1httrqq/job_working_directory/000/36/outputs/dataset_517e5dbf-2bd7-46ec-808c-246558598585.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac370916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmpw1httrqq/job_working_directory/000/37/configs/tmpjb6r3x50' '/tmp/tmpw1httrqq/files/5/1/7/dataset_517e5dbf-2bd7-46ec-808c-246558598585.dat' > '/tmp/tmpw1httrqq/job_working_directory/000/37/outputs/dataset_5a4c2c07-8e4d-4868-bcc4-16640070a00e.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac370916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmpw1httrqq/files/5/a/4/dataset_5a4c2c07-8e4d-4868-bcc4-16640070a00e.dat > '/tmp/tmpw1httrqq/job_working_directory/000/38/outputs/dataset_9119ff35-f84d-4943-b30a-cf03fa540a18.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac370916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpw1httrqq/files/5/a/4/dataset_5a4c2c07-8e4d-4868-bcc4-16640070a00e.dat" "/tmp/tmpw1httrqq/job_working_directory/000/39/outputs/dataset_aceaed54-4445-4dba-b18e-0ee2731ec063.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac370916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac370916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac370916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1778748", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpw1httrqq/job_working_directory/000/61/configs/tmpdqhbz22x' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpw1httrqq/files/a/c/e/dataset_aceaed54-4445-4dba-b18e-0ee2731ec063.dat' '/tmp/tmpw1httrqq/job_working_directory/000/61/outputs/dataset_3f24c921-c05b-4eca-a030-62c4e3b1096e.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1778748
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1778748;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 72 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac370916b11ef956ea77344e9b50b" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1778748"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 44: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmpw1httrqq/job_working_directory/000/41/configs/tmpiw9lgir9' '/tmp/tmpw1httrqq/files/6/b/6/dataset_6b6531c1-4ef4-489e-a637-97cc4add03ca.dat' > '/tmp/tmpw1httrqq/job_working_directory/000/41/outputs/dataset_5e598956-33f7-41ca-bc70-f15d2b3bf5be.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 45: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmpw1httrqq/job_working_directory/000/42/configs/tmpnpsc947z' '/tmp/tmpw1httrqq/files/b/2/7/dataset_b278594b-28eb-4970-8cce-fc7c42535218.dat' > '/tmp/tmpw1httrqq/job_working_directory/000/42/outputs/dataset_04888cdc-02cd-4858-92c6-bb8aa7319b31.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 46: join1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/tmpw1httrqq/galaxy-dev/tools/filters/join.py' '/tmp/tmpw1httrqq/files/c/5/c/dataset_c5c836e4-c4df-4bc4-8ade-fbce12d17263.dat' '/tmp/tmpw1httrqq/files/a/7/3/dataset_a73bfdcf-e6aa-4af0-8cfd-50a403a113b0.dat' 1 1 '/tmp/tmpw1httrqq/job_working_directory/000/50/outputs/dataset_d2111b56-0be5-407b-904e-cdf8430ea95e.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmpw1httrqq/job_working_directory/000/50/configs/tmpi6oo9pci
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | field1 | ` "1" ` |
             | field2 | ` "1" ` |
             | fill\_empty\_columns | ` {"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"} ` |
             | header | ` "" ` |
             | partial | ` "-p" ` |
             | unmatched | ` "-u" ` |

      </details>

 - **Step 47: Plot Data**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: Primary data**:

         * step_state: scheduled

      - **Step 2: Alternate data**:

         * step_state: scheduled

      - **Step 11: Size Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpw1httrqq/job_working_directory/000/69/configs/tmp57za_jyd' && Rscript '/tmp/tmpw1httrqq/job_working_directory/000/69/configs/tmp57za_jyd'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmpw1httrqq/files/7/2/7/dataset_72723e99-5c64-4372-bd31-8f144bb8fc5e.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmpw1httrqq/job_working_directory/000/69/outputs/dataset_2ac52d0e-080f-4d12-8653-2b7547cc486a.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac371916b11ef956ea77344e9b50b" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "Scaffold number" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Cumulative Size (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>

      - **Step 3: Name of primary assembly**:

         * step_state: scheduled

      - **Step 4: Name of alternate assembly**:

         * step_state: scheduled

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpw1httrqq/files/3/f/2/dataset_3f24c921-c05b-4eca-a030-62c4e3b1096e.dat" "/tmp/tmpw1httrqq/job_working_directory/000/63/outputs/dataset_d008fe3c-0777-4100-bc09-58c9204f7ad7.dat" "Hap1" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac371916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap1" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpw1httrqq/files/6/6/a/dataset_66ab8a72-3c0f-40dc-bc0e-4fa1a6b7960d.dat" "/tmp/tmpw1httrqq/job_working_directory/000/64/outputs/dataset_013f1995-9673-4553-9c7b-343bc04e62ad.dat" "Hap2" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac371916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap2" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cat/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpw1httrqq/files/d/0/0/dataset_d008fe3c-0777-4100-bc09-58c9204f7ad7.dat' >> '/tmp/tmpw1httrqq/job_working_directory/000/65/outputs/dataset_9f504a53-c3bd-4ddd-a12a-f1fa93bd46f8.dat' && cat '/tmp/tmpw1httrqq/files/0/1/3/dataset_013f1995-9673-4553-9c7b-343bc04e62ad.dat' >> '/tmp/tmpw1httrqq/job_working_directory/000/65/outputs/dataset_9f504a53-c3bd-4ddd-a12a-f1fa93bd46f8.dat' && exit 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac371916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | queries | ` [{"__index__": 0, "inputs2": {"values": [{"id": 110, "src": "hda"}]}}] ` |

           </details>

      - **Step 8: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmpw1httrqq/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpw1httrqq/files/9/f/5/dataset_9f504a53-c3bd-4ddd-a12a-f1fa93bd46f8.dat' 'c8,c5,c6' T '/tmp/tmpw1httrqq/job_working_directory/000/66/outputs/dataset_a4abdd35-0c97-4dc8-84cf-06ad0455ccf5.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac371916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c5,c6" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 9: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmpw1httrqq/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpw1httrqq/files/9/f/5/dataset_9f504a53-c3bd-4ddd-a12a-f1fa93bd46f8.dat' 'c8,c4,c7' T '/tmp/tmpw1httrqq/job_working_directory/000/67/outputs/dataset_72723e99-5c64-4372-bd31-8f144bb8fc5e.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac371916b11ef956ea77344e9b50b" ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c4,c7" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 10: Nx Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpw1httrqq/job_working_directory/000/68/configs/tmpy2_9_f8t' && Rscript '/tmp/tmpw1httrqq/job_working_directory/000/68/configs/tmpy2_9_f8t'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmpw1httrqq/files/a/4/a/dataset_a4abdd35-0c97-4dc8-84cf-06ad0455ccf5.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmpw1httrqq/job_working_directory/000/68/outputs/dataset_d66becb6-d0d7-4215-af9b-54252373e1ed.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac371916b11ef956ea77344e9b50b" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "x" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Nx (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>
       </details>

 - **Step 48: Busco Hap2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmpw1httrqq/files/5/e/5/dataset_5e598956-33f7-41ca-bc70-f15d2b3bf5be.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-10-23 18:39:36 ERROR:   Something went wrong. Results not recorded.
           2024-10-23 18:39:36 ERROR:   BUSCO analysis failed!
           2024-10-23 18:39:36 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-10-23 18:28:45 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 10/23/2024 18:28:45 *****
           2024-10-23 18:28:45 INFO:    Configuring BUSCO with local environment
           2024-10-23 18:28:45 INFO:    Running genome mode
           2024-10-23 18:29:02 INFO:    Input file is /tmp/tmpw1httrqq/files/5/e/5/dataset_5e598956-33f7-41ca-bc70-f15d2b3bf5be.dat
           2024-10-23 18:29:02 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:29:02 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:29:03 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-10-23 18:29:03 INFO:    Running 1 job(s) on bbtools, starting at 10/23/2024 18:29:03
           2024-10-23 18:29:04 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-10-23 18:29:04 INFO:    Running 1 job(s) on miniprot_index, starting at 10/23/2024 18:29:04
           2024-10-23 18:29:05 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-10-23 18:29:05 INFO:    Running 1 job(s) on miniprot_align, starting at 10/23/2024 18:29:05
           2024-10-23 18:39:04 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-10-23 18:39:07 INFO:    ***** Run HMMER on gene sequences *****
           2024-10-23 18:39:07 INFO:    Running 395 job(s) on hmmsearch, starting at 10/23/2024 18:39:07
           2024-10-23 18:39:11 INFO:    [hmmsearch] 40 of 395 task(s) completed
           2024-10-23 18:39:13 INFO:    [hmmsearch] 79 of 395 task(s) completed
           2024-10-23 18:39:16 INFO:    [hmmsearch] 119 of 395 task(s) completed
           2024-10-23 18:39:18 INFO:    [hmmsearch] 158 of 395 task(s) completed
           2024-10-23 18:39:20 INFO:    [hmmsearch] 198 of 395 task(s) completed
           2024-10-23 18:39:22 INFO:    [hmmsearch] 237 of 395 task(s) completed
           2024-10-23 18:39:24 INFO:    [hmmsearch] 277 of 395 task(s) completed
           2024-10-23 18:39:26 INFO:    [hmmsearch] 316 of 395 task(s) completed
           2024-10-23 18:39:30 INFO:    [hmmsearch] 356 of 395 task(s) completed
           2024-10-23 18:39:36 INFO:    [hmmsearch] 395 of 395 task(s) completed
           2024-10-23 18:39:36 INFO:    21 exons in total
           2024-10-23 18:39:36 WARNING: 1 of 16 Complete matches (6.2%) contain internal stop codons in Miniprot gene predictions

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 49: Merqury**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           mkdir -p output_files && mkdir -p read-db.meryl && tar -zxf /tmp/tmpw1httrqq/files/9/6/6/dataset_9663bc87-4bc6-453a-a258-efe209a32362.dat -C read-db.meryl --strip-components=1 && ln -s '/tmp/tmpw1httrqq/files/0/4/8/dataset_04888cdc-02cd-4858-92c6-bb8aa7319b31.dat' assembly_01.fasta && ln -s '/tmp/tmpw1httrqq/files/5/e/5/dataset_5e598956-33f7-41ca-bc70-f15d2b3bf5be.dat' assembly_02.fasta && merqury.sh read-db.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmpw1httrqq/job_working_directory/000/44/outputs/dataset_2e11a62d-8f4c-4ee4-854a-c13b86e7281f.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | label | ` "output_merqury" ` |
             | mode | ` {"__current_case__": 0, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 50, "src": "hda"}]}, "assembly_02": {"values": [{"id": 49, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 5, "src": "hda"}]}, "options": "default"} ` |
             | output\_add\_headers | ` true ` |
             | output\_selector | ` ["qv", "plots", "stats", "log", "hist"] ` |

      </details>

 - **Step 50: Busco Hap1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmpw1httrqq/files/0/4/8/dataset_04888cdc-02cd-4858-92c6-bb8aa7319b31.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-10-23 18:45:48 ERROR:   Something went wrong. Results not recorded.
           2024-10-23 18:45:48 ERROR:   BUSCO analysis failed!
           2024-10-23 18:45:48 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-10-23 18:28:45 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 10/23/2024 18:28:45 *****
           2024-10-23 18:28:45 INFO:    Configuring BUSCO with local environment
           2024-10-23 18:28:45 INFO:    Running genome mode
           2024-10-23 18:29:02 INFO:    Input file is /tmp/tmpw1httrqq/files/0/4/8/dataset_04888cdc-02cd-4858-92c6-bb8aa7319b31.dat
           2024-10-23 18:29:02 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:29:02 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:29:03 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-10-23 18:29:03 INFO:    Running 1 job(s) on bbtools, starting at 10/23/2024 18:29:03
           2024-10-23 18:29:04 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-10-23 18:29:04 INFO:    Running 1 job(s) on miniprot_index, starting at 10/23/2024 18:29:04
           2024-10-23 18:29:05 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-10-23 18:29:05 INFO:    Running 1 job(s) on miniprot_align, starting at 10/23/2024 18:29:05
           2024-10-23 18:45:18 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-10-23 18:45:24 INFO:    ***** Run HMMER on gene sequences *****
           2024-10-23 18:45:25 INFO:    Running 584 job(s) on hmmsearch, starting at 10/23/2024 18:45:25
           2024-10-23 18:45:29 INFO:    [hmmsearch] 59 of 584 task(s) completed
           2024-10-23 18:45:31 INFO:    [hmmsearch] 117 of 584 task(s) completed
           2024-10-23 18:45:33 INFO:    [hmmsearch] 176 of 584 task(s) completed
           2024-10-23 18:45:35 INFO:    [hmmsearch] 234 of 584 task(s) completed
           2024-10-23 18:45:37 INFO:    [hmmsearch] 292 of 584 task(s) completed
           2024-10-23 18:45:40 INFO:    [hmmsearch] 351 of 584 task(s) completed
           2024-10-23 18:45:42 INFO:    [hmmsearch] 409 of 584 task(s) completed
           2024-10-23 18:45:43 INFO:    [hmmsearch] 468 of 584 task(s) completed
           2024-10-23 18:45:46 INFO:    [hmmsearch] 526 of 584 task(s) completed
           2024-10-23 18:45:48 INFO:    [hmmsearch] 584 of 584 task(s) completed
           2024-10-23 18:45:48 INFO:    42 exons in total
           2024-10-23 18:45:48 WARNING: 2 of 33 Complete matches (6.1%) contain internal stop codons in Miniprot gene predictions
           2024-10-23 18:45:48 WARNING: BUSCO gene predictions from Miniprot have low average identity (0.4399999976158142). You may want to repeat the analysis using the Metaeuk pipeline.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 6: Database for Busco Lineage**:

    * step_state: scheduled

 - **Step 51: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cut\_tool/9.3+galaxy2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cut --complement -f '3' '/tmp/tmpw1httrqq/files/d/2/1/dataset_d2111b56-0be5-407b-904e-cdf8430ea95e.dat' > '/tmp/tmpw1httrqq/job_working_directory/000/51/outputs/dataset_eeb95c84-2eb2-4b62-9e2f-e1559159e927.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | complement | ` "--complement" ` |
             | cut\_type\_options | ` {"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""} ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 52: output_merqury.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 53: output_merqury.spectra-asm.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 54: merqury_qv**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | input | ` {"values": [{"id": 10, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 55: output_merqury.assembly_01.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 56: merqury_stats**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | input | ` {"values": [{"id": 12, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 57: output_merqury.assembly_02.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 58: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_find\_and\_replace/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmpw1httrqq/job_working_directory/000/52/outputs/dataset_c085b760-9667-44c8-a40f-6e31af7a45cd.dat' -g     '#' 'Number of' '/tmp/tmpw1httrqq/files/e/e/b/dataset_eeb95c84-2eb2-4b62-9e2f-e1559159e927.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "715ac36e916b11ef956ea77344e9b50b" ` |
             | chromInfo | ` "/tmp/tmpw1httrqq/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | find\_and\_replace | ` [{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}] ` |

      </details>

 - **Step 7: Lineage**:

    * step_state: scheduled

 - **Step 8: Name for Haplotype 1**:

    * step_state: scheduled

 - **Step 9: Name for Haplotype 2**:

    * step_state: scheduled

 - **Step 10: Bits for bloom filter**:

    * step_state: scheduled

  </details>
  • Other invocation details - **history_id** * 97cbf404e0eceadd - **history_state** * ok - **invocation_id** * 97cbf404e0eceadd - **invocation_state** * scheduled - **workflow_id** * 186a8d9108164e2a

github-actions[bot] commented 6 days ago

Test Results (powered by Planemo)

Test Summary

Test State Count
Total 1
Passed 0
Error 0
Failure 1
Skipped 0
Failed Tests *
❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0
**Problems**: * ``` Output with path /tmp/tmpxe4gqpei/Hifiasm HiC hap1__62716d83-ac77-4f75-927a-33240a955c5c different than expected Expected 168+-0 lines in the output found 144 ``` * ``` Output with path /tmp/tmpy0ek1kvk/usable hap1 gfa__bc4d4a26-d5e2-4447-b7ab-26e896746db3 different than expected Expected 173+-0 lines in the output found 145 ``` #### Workflow invocation details * Invocation Messages *
Steps - **Step 1: Pacbio Reads Collection**: * step_state: scheduled - **Step 2: Collection of Hi-C Forward reads**: * step_state: scheduled - **Step 11: SAK input file**: * step_state: scheduled - **Step 12: Homozygous Read Coverage**: * step_state: scheduled - **Step 13: Genomescope Model Parameters**: * step_state: scheduled - **Step 14: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1**: * step_state: scheduled *
Jobs - **Job 1:** * Job state is ok **Command Line:** * ```console ln -f -s '/tmp/tmpa6b2fkb_/files/7/4/0/dataset_7403e0b2-e51c-4d38-8bff-e5bcf5e91e67.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' && cutadapt -j=${GALAXY_SLOTS:-4} -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT' -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT' --error-rate=0.1 --times=1 --overlap=35 --action=trim --rc --discard-trimmed --minimum-length=1 --json=stats.json -o 'out1.fq.gz' 'yeast_reads_sub1_fastq_gz.fq.gz' > report.txt ``` **Exit Code:** * ```console 0 ``` **Traceback:** * ```console ``` **Job Parameters:** * | Job parameter | Parameter value | | ------------- | --------------- | | \_\_input\_ext | ` "input" ` | | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` | | adapter\_options | ` {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"} ` | | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` | | dbkey | ` "?" ` | | filter\_options | ` {"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"} ` | | library | ` {"__current_case__": 0, "input_1": {"values": [{"id": 3, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"} ` | | other\_trimming\_options | ` {"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false} ` | | output\_selector | ` ["report", "json_stats"] ` | | read\_mod\_options | ` {"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false} ` | 
 - **Step 15: \_\_SORTLIST\_\_**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | input | ` {"values": [{"id": 1, "src": "hdca"}]} ` |
             | sort\_type | ` {"__current_case__": 0, "sort_type": "alpha"} ` |

      </details>

 - **Step 16: \_\_SORTLIST\_\_**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | input | ` {"values": [{"id": 2, "src": "hdca"}]} ` |
             | sort\_type | ` {"__current_case__": 0, "sort_type": "alpha"} ` |

      </details>

 - **Step 17: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_grep\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpa6b2fkb_/files/e/f/1/dataset_ef1b2cfb-0289-4b8d-8c1d-81a8f0bd0cbd.dat' > '/tmp/tmpa6b2fkb_/job_working_directory/000/10/outputs/dataset_769625dd-981e-4862-b2c2-9dabf48fa53a.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | case\_sensitive | ` "-i" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | color | ` "NOCOLOR" ` |
             | dbkey | ` "?" ` |
             | invert | ` "" ` |
             | lines\_after | ` "0" ` |
             | lines\_before | ` "0" ` |
             | regex\_type | ` "-G" ` |
             | url\_paste | ` "Haploid" ` |

      </details>

 - **Step 18: pick\_value**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "data" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | style\_cond | ` {"__current_case__": 1, "pick_style": "first_or_default", "type_cond": {"__current_case__": 1, "default_value": "37", "param_type": "integer", "pick_from": [{"__index__": 0, "value": "32"}]}} ` |

      </details>

 - **Step 19: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmpa6b2fkb_/job_working_directory/000/12/configs/tmpum7t_1u2' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpa6b2fkb_/files/a/9/1/dataset_a91670fe-bba9-43dd-a3f2-134804d61ea4.dat' '/tmp/tmpa6b2fkb_/job_working_directory/000/12/outputs/dataset_0c0e7bc3-49cd-4975-865d-d9bd4aa7242a.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           c3*2
           Computing 1 new columns with instructions ['c3*2;;']
           Computed new column values for 100.00% of 1 lines written.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | avoid\_scientific\_notation | ` false ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
             | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"} ` |

      </details>

 - **Step 20: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpa6b2fkb_/files/0/d/b/dataset_0dbaad55-d856-4221-a1d0-42d77f11d2fc.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console

           /// MultiQC 🔍 v1.24.1

                version_check | MultiQC Version v1.25.1 now available!
                  file_search | Search path: /tmp/tmpa6b2fkb_/job_working_directory/000/13/working/multiqc_WDir

                     cutadapt | Found 1 reports

                write_results | Data        : report_data
                write_results | Report      : report.html
                      multiqc | MultiQC complete

           ```
        **Standard Output:**

         * ```console
           total 72
           -rw-r--r-- 1 1001 127    93 Oct 23 18:24 cutadapt_filtered_reads_plot.txt
           -rw-r--r-- 1 1001 127    66 Oct 23 18:24 cutadapt_trimmed_sequences_plot_default_Counts.txt
           -rw-r--r-- 1 1001 127    70 Oct 23 18:24 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
           -rw-r--r-- 1 1001 127   124 Oct 23 18:24 multiqc_citations.txt
           -rw-r--r-- 1 1001 127   222 Oct 23 18:24 multiqc_cutadapt.txt
           -rw-r--r-- 1 1001 127 39114 Oct 23 18:24 multiqc_data.json
           -rw-r--r-- 1 1001 127   105 Oct 23 18:24 multiqc_general_stats.txt
           -rw-r--r-- 1 1001 127    29 Oct 23 18:24 multiqc_software_versions.txt
           -rw-r--r-- 1 1001 127   194 Oct 23 18:24 multiqc_sources.txt

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | comment | ` "" ` |
             | dbkey | ` "?" ` |
             | export | ` false ` |
             | flat | ` false ` |
             | results | ` [{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "cutadapt"}}] ` |
             | saveLog | ` "false" ` |
             | title | ` "" ` |

      </details>

 - **Step 3: Collection of Hi-C Reverse reads**:

    * step_state: scheduled

 - **Step 21: Hi-C Forward Reads**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           (   cat "/tmp/tmpa6b2fkb_/files/a/e/e/dataset_aee561a4-5cbd-4876-8804-ab3c9b208ad3.dat" ;   ) > /tmp/tmpa6b2fkb_/job_working_directory/000/14/outputs/dataset_76f65732-200f-480a-85f3-f2bc4c685e0a.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filename | ` {"__current_case__": 1, "add_name": false} ` |
             | one\_header | ` false ` |

      </details>

 - **Step 22: Hi-C Reverse Reads**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           (   cat "/tmp/tmpa6b2fkb_/files/b/0/2/dataset_b02f3a30-24b8-4700-990d-bf6669c9b578.dat" ;   ) > /tmp/tmpa6b2fkb_/job_working_directory/000/15/outputs/dataset_b188829e-c1df-4dca-a3d1-3e8a330de1ef.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filename | ` {"__current_case__": 1, "add_name": false} ` |
             | one\_header | ` false ` |

      </details>

 - **Step 23: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_replace\_in\_line/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmpa6b2fkb_/files/7/6/9/dataset_769625dd-981e-4862-b2c2-9dabf48fa53a.dat' > '/tmp/tmpa6b2fkb_/job_working_directory/000/16/outputs/dataset_8959102c-1adc-44a8-9cc3-ec357276f67d.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | replacements | ` [{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}] ` |

      </details>

 - **Step 24: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmpa6b2fkb_/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpa6b2fkb_/files/0/c/0/dataset_0c0e7bc3-49cd-4975-865d-d9bd4aa7242a.dat' 'c7' T '/tmp/tmpa6b2fkb_/job_working_directory/000/17/outputs/dataset_faa61156-180f-40ac-8d23-3ffdf5b2f429.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c7" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 25: Convert characters1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python /tmp/tmpa6b2fkb_/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmpa6b2fkb_/files/8/9/5/dataset_8959102c-1adc-44a8-9cc3-ec357276f67d.dat s /tmp/tmpa6b2fkb_/job_working_directory/000/18/outputs/dataset_fbcb9a21-a55d-4185-963c-274005a23c42.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console

           Exception in thread Thread-57 (run_postfork):

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "txt" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | condense | ` true ` |
             | convert\_from | ` "s" ` |
             | dbkey | ` "?" ` |
             | strip | ` true ` |

      </details>

 - **Step 26: Estimated homozygous read coverage**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 27: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmpa6b2fkb_/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpa6b2fkb_/files/f/b/c/dataset_fbcb9a21-a55d-4185-963c-274005a23c42.dat' 'c3' T '/tmp/tmpa6b2fkb_/job_working_directory/000/20/outputs/dataset_06f83587-ec61-4fcc-a5e6-7b85f7e2a7d9.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c3" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 28: Homozygous read coverage for Hifiasm**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | style\_cond | ` {"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}} ` |

      </details>

 - **Step 29: Estimated genome size**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 30: Hifiasm**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmpa6b2fkb_/files/7/0/c/dataset_70cbd14d-d751-4b67-b8b6-e76664c15705.dat' input_0.fastq.gz &&  mkdir HiCF HiCR && ln -s '/tmp/tmpa6b2fkb_/files/7/6/f/dataset_76f65732-200f-480a-85f3-f2bc4c685e0a.dat' ./HiCF/input_0.fastqsanger.gz &&  ln -s '/tmp/tmpa6b2fkb_/files/b/1/8/dataset_b188829e-c1df-4dca-a3d1-3e8a330de1ef.dat' ./HiCR/input_0.fastqsanger.gz &&  hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21  --h1 './HiCF/input_0.fastqsanger.gz' --h2 './HiCR/input_0.fastqsanger.gz' --l-msjoin 500000   --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "fastq.gz" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | advanced\_options | ` {"__current_case__": 0, "advanced_selector": "blank"} ` |
             | assembly\_options | ` {"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"} ` |
             | bins\_out | ` false ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filter\_bits | ` "32" ` |
             | hic\_partition | ` {"__current_case__": 1, "f_perturb": null, "h1": {"values": [{"id": 17, "src": "hda"}]}, "h2": {"values": [{"id": 18, "src": "hda"}]}, "hic_partition_selector": "set", "l_msjoin": "500000", "n_perturb": null, "n_weight": null, "seed": null} ` |
             | log\_out | ` true ` |
             | mode | ` {"__current_case__": 0, "mode_selector": "standard", "reads": {"values": [{"id": 4, "src": "hdca"}]}} ` |
             | ont\_integration | ` {"__current_case__": 0, "ont_integration_selector": "blank"} ` |
             | purge\_options | ` {"__current_case__": 0, "purge_selector": "blank"} ` |
             | scaffolding\_options | ` {"__current_case__": 0, "scaffold_selector": "blank"} ` |

      </details>

 - **Step 4: Genomescope Summary**:

    * step_state: scheduled

 - **Step 31: Raw Unitig Image**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmpa6b2fkb_/files/2/d/5/dataset_2d5bea04-5b27-4214-bcd6-cfe5dc6e75ca.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | fontsize | ` None ` |
             | height | ` "2000" ` |
             | lengths | ` false ` |
             | names | ` false ` |
             | nodewidth | ` "25.0" ` |
             | output\_format | ` "png" ` |
             | width | ` None ` |

      </details>

 - **Step 32: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpa6b2fkb_/files/f/1/e/dataset_f1ed1312-a874-421a-9c5e-a6cf719b0faf.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpa6b2fkb_/job_working_directory/000/25/outputs/dataset_bdb64f98-45b0-41e6-a546-7ffdf32d9981.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 33: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpa6b2fkb_/files/9/e/f/dataset_9efd7031-91b4-4955-894a-49d1508c409c.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpa6b2fkb_/job_working_directory/000/26/outputs/dataset_ced11e98-d8d2-4405-afbd-ba2629ee6957.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 34: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpa6b2fkb_/files/f/1/e/dataset_f1ed1312-a874-421a-9c5e-a6cf719b0faf.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpa6b2fkb_/job_working_directory/000/27/outputs/dataset_2ec009ef-3bf4-4ee6-93c9-a923711a47c9.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 35: gfastats gfa hap2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpa6b2fkb_/files/f/1/e/dataset_f1ed1312-a874-421a-9c5e-a6cf719b0faf.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpa6b2fkb_/files/9/e/f/dataset_9efd7031-91b4-4955-894a-49d1508c409c.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpa6b2fkb_/job_working_directory/000/29/outputs/dataset_25eeaa49-16fe-49ec-bf95-828593729fcd.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 37: gfastats gfa hap1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpa6b2fkb_/files/9/e/f/dataset_9efd7031-91b4-4955-894a-49d1508c409c.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 38: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpa6b2fkb_/files/f/1/e/dataset_f1ed1312-a874-421a-9c5e-a6cf719b0faf.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 39: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpa6b2fkb_/files/9/e/f/dataset_9efd7031-91b4-4955-894a-49d1508c409c.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 40: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmpa6b2fkb_/job_working_directory/000/33/configs/tmpn2zns_fk' '/tmp/tmpa6b2fkb_/files/b/d/b/dataset_bdb64f98-45b0-41e6-a546-7ffdf32d9981.dat' > '/tmp/tmpa6b2fkb_/job_working_directory/000/33/outputs/dataset_79e8738c-d417-4760-a6c5-78145f830d85.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap2\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 5: Meryl Database**:

    * step_state: scheduled

 - **Step 41: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmpa6b2fkb_/job_working_directory/000/34/configs/tmpa9m5rk5s' '/tmp/tmpa6b2fkb_/files/c/e/d/dataset_ced11e98-d8d2-4405-afbd-ba2629ee6957.dat' > '/tmp/tmpa6b2fkb_/job_working_directory/000/34/outputs/dataset_36a6cdf9-6739-4e61-8c49-e5bca49334ec.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap1\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 42: Data Prep Hap2**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmpa6b2fkb_/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpa6b2fkb_/files/2/e/c/dataset_2ec009ef-3bf4-4ee6-93c9-a923711a47c9.dat' --output='/tmp/tmpa6b2fkb_/job_working_directory/000/35/outputs/dataset_7a6d6937-056c-4e44-90f9-9a94e7fc9eb4.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cb916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmpa6b2fkb_/job_working_directory/000/36/configs/tmpkg_42g7d' '/tmp/tmpa6b2fkb_/files/7/a/6/dataset_7a6d6937-056c-4e44-90f9-9a94e7fc9eb4.dat' > '/tmp/tmpa6b2fkb_/job_working_directory/000/36/outputs/dataset_403bfb55-ae3a-49da-8a61-981e17bdcd5b.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cb916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmpa6b2fkb_/files/4/0/3/dataset_403bfb55-ae3a-49da-8a61-981e17bdcd5b.dat > '/tmp/tmpa6b2fkb_/job_working_directory/000/37/outputs/dataset_d37f1fd0-da19-442a-bf65-0b3622e10a93.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cb916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpa6b2fkb_/files/4/0/3/dataset_403bfb55-ae3a-49da-8a61-981e17bdcd5b.dat" "/tmp/tmpa6b2fkb_/job_working_directory/000/38/outputs/dataset_fdc4b894-6b11-4816-9ec0-3458bceef76d.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cb916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cb916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cb916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1008829", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpa6b2fkb_/job_working_directory/000/61/configs/tmp5_ks3dqc' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpa6b2fkb_/files/f/d/c/dataset_fdc4b894-6b11-4816-9ec0-3458bceef76d.dat' '/tmp/tmpa6b2fkb_/job_working_directory/000/61/outputs/dataset_735304e5-4054-472e-a630-def069567d98.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1008829
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1008829;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 35 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cb916b11efa0505d6d459ec8c6" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1008829"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 43: Data Prep Hap1**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmpa6b2fkb_/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpa6b2fkb_/files/2/5/e/dataset_25eeaa49-16fe-49ec-bf95-828593729fcd.dat' --output='/tmp/tmpa6b2fkb_/job_working_directory/000/40/outputs/dataset_7ace50db-98a9-401c-913c-25ad29e08152.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cc916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmpa6b2fkb_/job_working_directory/000/41/configs/tmp20bgj4pg' '/tmp/tmpa6b2fkb_/files/7/a/c/dataset_7ace50db-98a9-401c-913c-25ad29e08152.dat' > '/tmp/tmpa6b2fkb_/job_working_directory/000/41/outputs/dataset_5aacebbf-5fea-4125-96ef-63fc25b1b7a5.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cc916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmpa6b2fkb_/files/5/a/a/dataset_5aacebbf-5fea-4125-96ef-63fc25b1b7a5.dat > '/tmp/tmpa6b2fkb_/job_working_directory/000/42/outputs/dataset_e090cc70-f3ad-4a1c-8aca-349f92286d87.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cc916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpa6b2fkb_/files/5/a/a/dataset_5aacebbf-5fea-4125-96ef-63fc25b1b7a5.dat" "/tmp/tmpa6b2fkb_/job_working_directory/000/43/outputs/dataset_2a0b33a1-525a-481c-9119-02602caf01d7.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cc916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cc916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cc916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1778748", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpa6b2fkb_/job_working_directory/000/62/configs/tmpd10a4qgl' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpa6b2fkb_/files/2/a/0/dataset_2a0b33a1-525a-481c-9119-02602caf01d7.dat' '/tmp/tmpa6b2fkb_/job_working_directory/000/62/outputs/dataset_83afd887-10c1-478d-a406-c61985d7028f.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1778748
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1778748;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 72 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cc916b11efa0505d6d459ec8c6" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1778748"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 44: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmpa6b2fkb_/job_working_directory/000/45/configs/tmpvlddc7by' '/tmp/tmpa6b2fkb_/files/7/4/9/dataset_749902b7-9cde-4175-a712-f94be5972d91.dat' > '/tmp/tmpa6b2fkb_/job_working_directory/000/45/outputs/dataset_f83cf926-5f6a-44b1-9553-a1590834a447.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 45: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmpa6b2fkb_/job_working_directory/000/46/configs/tmp9be76ph0' '/tmp/tmpa6b2fkb_/files/8/a/b/dataset_8ab0f62f-2108-413a-8501-fd926ecfa776.dat' > '/tmp/tmpa6b2fkb_/job_working_directory/000/46/outputs/dataset_62716d83-ac77-4f75-927a-33240a955c5c.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 46: join1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/tmpa6b2fkb_/galaxy-dev/tools/filters/join.py' '/tmp/tmpa6b2fkb_/files/3/6/a/dataset_36a6cdf9-6739-4e61-8c49-e5bca49334ec.dat' '/tmp/tmpa6b2fkb_/files/7/9/e/dataset_79e8738c-d417-4760-a6c5-78145f830d85.dat' 1 1 '/tmp/tmpa6b2fkb_/job_working_directory/000/47/outputs/dataset_15b2edc8-a72c-4bec-9f52-d2f9aa6df4b4.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmpa6b2fkb_/job_working_directory/000/47/configs/tmp9kj63ql7
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | field1 | ` "1" ` |
             | field2 | ` "1" ` |
             | fill\_empty\_columns | ` {"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"} ` |
             | header | ` "" ` |
             | partial | ` "-p" ` |
             | unmatched | ` "-u" ` |

      </details>

 - **Step 47: Plot Data**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: Primary data**:

         * step_state: scheduled

      - **Step 2: Alternate data**:

         * step_state: scheduled

      - **Step 11: Size Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpa6b2fkb_/job_working_directory/000/69/configs/tmpm9cnmum8' && Rscript '/tmp/tmpa6b2fkb_/job_working_directory/000/69/configs/tmpm9cnmum8'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmpa6b2fkb_/files/0/3/3/dataset_0335ad30-31b4-497c-b5cd-978f4a08d879.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmpa6b2fkb_/job_working_directory/000/69/outputs/dataset_48664c08-ab01-4793-bf95-0cecabd367d4.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cd916b11efa0505d6d459ec8c6" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "Scaffold number" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Cumulative Size (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>

      - **Step 3: Name of primary assembly**:

         * step_state: scheduled

      - **Step 4: Name of alternate assembly**:

         * step_state: scheduled

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpa6b2fkb_/files/8/3/a/dataset_83afd887-10c1-478d-a406-c61985d7028f.dat" "/tmp/tmpa6b2fkb_/job_working_directory/000/63/outputs/dataset_41c97728-86ed-4a51-8aa8-9414711f184c.dat" "Hap1" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cd916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap1" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpa6b2fkb_/files/7/3/5/dataset_735304e5-4054-472e-a630-def069567d98.dat" "/tmp/tmpa6b2fkb_/job_working_directory/000/64/outputs/dataset_89df8957-c178-496d-8471-526f2ea2e235.dat" "Hap2" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cd916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap2" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cat/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpa6b2fkb_/files/4/1/c/dataset_41c97728-86ed-4a51-8aa8-9414711f184c.dat' >> '/tmp/tmpa6b2fkb_/job_working_directory/000/65/outputs/dataset_ae1d2272-ed62-4a64-b8b7-3a2514cf7c21.dat' && cat '/tmp/tmpa6b2fkb_/files/8/9/d/dataset_89df8957-c178-496d-8471-526f2ea2e235.dat' >> '/tmp/tmpa6b2fkb_/job_working_directory/000/65/outputs/dataset_ae1d2272-ed62-4a64-b8b7-3a2514cf7c21.dat' && exit 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cd916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | queries | ` [{"__index__": 0, "inputs2": {"values": [{"id": 110, "src": "hda"}]}}] ` |

           </details>

      - **Step 8: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmpa6b2fkb_/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpa6b2fkb_/files/a/e/1/dataset_ae1d2272-ed62-4a64-b8b7-3a2514cf7c21.dat' 'c8,c5,c6' T '/tmp/tmpa6b2fkb_/job_working_directory/000/66/outputs/dataset_f12659e8-6c04-4b2c-80b9-4cfd9ee511d6.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cd916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c5,c6" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 9: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmpa6b2fkb_/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpa6b2fkb_/files/a/e/1/dataset_ae1d2272-ed62-4a64-b8b7-3a2514cf7c21.dat' 'c8,c4,c7' T '/tmp/tmpa6b2fkb_/job_working_directory/000/67/outputs/dataset_0335ad30-31b4-497c-b5cd-978f4a08d879.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cd916b11efa0505d6d459ec8c6" ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c4,c7" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 10: Nx Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpa6b2fkb_/job_working_directory/000/68/configs/tmpvg_yt7xb' && Rscript '/tmp/tmpa6b2fkb_/job_working_directory/000/68/configs/tmpvg_yt7xb'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmpa6b2fkb_/files/f/1/2/dataset_f12659e8-6c04-4b2c-80b9-4cfd9ee511d6.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmpa6b2fkb_/job_working_directory/000/68/outputs/dataset_47ca5612-b03e-4ef7-8aa3-c0f764cad739.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06cd916b11efa0505d6d459ec8c6" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "x" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Nx (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>
       </details>

 - **Step 48: Busco Hap2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmpa6b2fkb_/files/f/8/3/dataset_f83cf926-5f6a-44b1-9553-a1590834a447.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-10-23 18:41:25 ERROR:   Something went wrong. Results not recorded.
           2024-10-23 18:41:25 ERROR:   BUSCO analysis failed!
           2024-10-23 18:41:25 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-10-23 18:30:37 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 10/23/2024 18:30:37 *****
           2024-10-23 18:30:37 INFO:    Configuring BUSCO with local environment
           2024-10-23 18:30:37 INFO:    Running genome mode
           2024-10-23 18:30:39 INFO:    Input file is /tmp/tmpa6b2fkb_/files/f/8/3/dataset_f83cf926-5f6a-44b1-9553-a1590834a447.dat
           2024-10-23 18:30:40 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:30:40 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:30:40 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-10-23 18:30:40 INFO:    Running 1 job(s) on bbtools, starting at 10/23/2024 18:30:40
           2024-10-23 18:30:41 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-10-23 18:30:41 INFO:    Running 1 job(s) on miniprot_index, starting at 10/23/2024 18:30:41
           2024-10-23 18:30:42 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-10-23 18:30:42 INFO:    Running 1 job(s) on miniprot_align, starting at 10/23/2024 18:30:42
           2024-10-23 18:40:48 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-10-23 18:40:51 INFO:    ***** Run HMMER on gene sequences *****
           2024-10-23 18:40:52 INFO:    Running 395 job(s) on hmmsearch, starting at 10/23/2024 18:40:52
           2024-10-23 18:40:56 INFO:    [hmmsearch] 40 of 395 task(s) completed
           2024-10-23 18:40:59 INFO:    [hmmsearch] 79 of 395 task(s) completed
           2024-10-23 18:41:03 INFO:    [hmmsearch] 119 of 395 task(s) completed
           2024-10-23 18:41:06 INFO:    [hmmsearch] 158 of 395 task(s) completed
           2024-10-23 18:41:09 INFO:    [hmmsearch] 198 of 395 task(s) completed
           2024-10-23 18:41:12 INFO:    [hmmsearch] 237 of 395 task(s) completed
           2024-10-23 18:41:15 INFO:    [hmmsearch] 277 of 395 task(s) completed
           2024-10-23 18:41:18 INFO:    [hmmsearch] 316 of 395 task(s) completed
           2024-10-23 18:41:21 INFO:    [hmmsearch] 356 of 395 task(s) completed
           2024-10-23 18:41:25 INFO:    [hmmsearch] 395 of 395 task(s) completed
           2024-10-23 18:41:25 INFO:    21 exons in total
           2024-10-23 18:41:25 WARNING: 1 of 16 Complete matches (6.2%) contain internal stop codons in Miniprot gene predictions

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 49: Merqury**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           mkdir -p output_files && mkdir -p read-db.meryl && tar -zxf /tmp/tmpa6b2fkb_/files/0/4/7/dataset_047b435b-8548-41bc-9eb6-ad76d71fc0c8.dat -C read-db.meryl --strip-components=1 && ln -s '/tmp/tmpa6b2fkb_/files/6/2/7/dataset_62716d83-ac77-4f75-927a-33240a955c5c.dat' assembly_01.fasta && ln -s '/tmp/tmpa6b2fkb_/files/f/8/3/dataset_f83cf926-5f6a-44b1-9553-a1590834a447.dat' assembly_02.fasta && merqury.sh read-db.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmpa6b2fkb_/job_working_directory/000/49/outputs/dataset_796da044-83dd-4514-bb5e-bc1e14f6476a.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | label | ` "output_merqury" ` |
             | mode | ` {"__current_case__": 0, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 54, "src": "hda"}]}, "assembly_02": {"values": [{"id": 53, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 5, "src": "hda"}]}, "options": "default"} ` |
             | output\_add\_headers | ` true ` |
             | output\_selector | ` ["qv", "plots", "stats", "log", "hist"] ` |

      </details>

 - **Step 50: Busco Hap1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmpa6b2fkb_/files/6/2/7/dataset_62716d83-ac77-4f75-927a-33240a955c5c.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-10-23 18:47:35 ERROR:   Something went wrong. Results not recorded.
           2024-10-23 18:47:35 ERROR:   BUSCO analysis failed!
           2024-10-23 18:47:35 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-10-23 18:30:37 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 10/23/2024 18:30:37 *****
           2024-10-23 18:30:37 INFO:    Configuring BUSCO with local environment
           2024-10-23 18:30:37 INFO:    Running genome mode
           2024-10-23 18:30:39 INFO:    Input file is /tmp/tmpa6b2fkb_/files/6/2/7/dataset_62716d83-ac77-4f75-927a-33240a955c5c.dat
           2024-10-23 18:30:40 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:30:40 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 18:30:40 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-10-23 18:30:40 INFO:    Running 1 job(s) on bbtools, starting at 10/23/2024 18:30:40
           2024-10-23 18:30:42 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-10-23 18:30:42 INFO:    Running 1 job(s) on miniprot_index, starting at 10/23/2024 18:30:42
           2024-10-23 18:30:43 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-10-23 18:30:43 INFO:    Running 1 job(s) on miniprot_align, starting at 10/23/2024 18:30:43
           2024-10-23 18:46:59 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-10-23 18:47:05 INFO:    ***** Run HMMER on gene sequences *****
           2024-10-23 18:47:05 INFO:    Running 584 job(s) on hmmsearch, starting at 10/23/2024 18:47:05
           2024-10-23 18:47:10 INFO:    [hmmsearch] 59 of 584 task(s) completed
           2024-10-23 18:47:13 INFO:    [hmmsearch] 117 of 584 task(s) completed
           2024-10-23 18:47:16 INFO:    [hmmsearch] 176 of 584 task(s) completed
           2024-10-23 18:47:18 INFO:    [hmmsearch] 234 of 584 task(s) completed
           2024-10-23 18:47:21 INFO:    [hmmsearch] 292 of 584 task(s) completed
           2024-10-23 18:47:24 INFO:    [hmmsearch] 351 of 584 task(s) completed
           2024-10-23 18:47:27 INFO:    [hmmsearch] 409 of 584 task(s) completed
           2024-10-23 18:47:29 INFO:    [hmmsearch] 468 of 584 task(s) completed
           2024-10-23 18:47:32 INFO:    [hmmsearch] 526 of 584 task(s) completed
           2024-10-23 18:47:35 INFO:    [hmmsearch] 584 of 584 task(s) completed
           2024-10-23 18:47:35 INFO:    42 exons in total
           2024-10-23 18:47:35 WARNING: 2 of 33 Complete matches (6.1%) contain internal stop codons in Miniprot gene predictions
           2024-10-23 18:47:35 WARNING: BUSCO gene predictions from Miniprot have low average identity (0.4399999976158142). You may want to repeat the analysis using the Metaeuk pipeline.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 6: Database for Busco Lineage**:

    * step_state: scheduled

 - **Step 51: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cut\_tool/9.3+galaxy2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cut --complement -f '3' '/tmp/tmpa6b2fkb_/files/1/5/b/dataset_15b2edc8-a72c-4bec-9f52-d2f9aa6df4b4.dat' > '/tmp/tmpa6b2fkb_/job_working_directory/000/51/outputs/dataset_25800707-5fbc-42c5-b8b2-cf69a3efd8c6.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | complement | ` "--complement" ` |
             | cut\_type\_options | ` {"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""} ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 52: output_merqury.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 53: output_merqury.spectra-asm.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 54: merqury_qv**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | input | ` {"values": [{"id": 10, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 55: output_merqury.assembly_01.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 56: merqury_stats**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | input | ` {"values": [{"id": 12, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 57: output_merqury.assembly_02.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 58: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_find\_and\_replace/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmpa6b2fkb_/job_working_directory/000/52/outputs/dataset_c6327dae-dcc5-403f-865a-ff4a767ddc00.dat' -g     '#' 'Number of' '/tmp/tmpa6b2fkb_/files/2/5/8/dataset_25800707-5fbc-42c5-b8b2-cf69a3efd8c6.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "b48c06ca916b11efa0505d6d459ec8c6" ` |
             | chromInfo | ` "/tmp/tmpa6b2fkb_/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | find\_and\_replace | ` [{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}] ` |

      </details>

 - **Step 7: Lineage**:

    * step_state: scheduled

 - **Step 8: Name for Haplotype 1**:

    * step_state: scheduled

 - **Step 9: Name for Haplotype 2**:

    * step_state: scheduled

 - **Step 10: Bits for bloom filter**:

    * step_state: scheduled

  </details>
  • Other invocation details - **history_id** * 818fff8b5c64458e - **history_state** * ok - **invocation_id** * 818fff8b5c64458e - **invocation_state** * scheduled - **workflow_id** * 48cda2f186642047

github-actions[bot] commented 6 days ago

Test Results (powered by Planemo)

Test Summary

Test State Count
Total 1
Passed 0
Error 1
Failure 0
Skipped 0
Errored Tests *
❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0
**Execution Problem:** * ``` Unexpected HTTP status code: 400: {"err_msg":"Workflow cannot be run because input step '82' (Trim Hi-C reads?) is not optional and no input provided.","err_code":0} ```

github-actions[bot] commented 6 days ago

Test Results (powered by Planemo)

Test Summary

Test State Count
Total 1
Passed 0
Error 1
Failure 0
Skipped 0
Errored Tests *
❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0
**Execution Problem:** * ``` Unexpected HTTP status code: 400: {"err_msg":"Workflow cannot be run because input step '82' (Trim Hi-C reads?) is not optional and no input provided.","err_code":0} ```

github-actions[bot] commented 6 days ago

Test Results (powered by Planemo)

Test Summary

Test State Count
Total 1
Passed 0
Error 0
Failure 1
Skipped 0
Failed Tests *
❌ Assembly-Hifi-HiC-phasing-VGP4.ga_0
**Problems**: * ``` Output with path /tmp/tmpimhz36ix/Hifiasm HiC hap1__861177db-ae02-4ef5-93a3-7ab31ec6c515 different than expected Expected 168+-0 lines in the output found 144 ``` * ``` Output with path /tmp/tmp73xst4ag/usable hap1 gfa__4ff7e963-5b8c-452a-9b58-dcb142b0a120 different than expected Expected 173+-0 lines in the output found 145 ``` #### Workflow invocation details * Invocation Messages *
Steps - **Step 1: Pacbio Reads Collection**: * step_state: scheduled - **Step 2: Trim Hi-C reads?**: * step_state: scheduled - **Step 11: Bits for bloom filter**: * step_state: scheduled - **Step 12: SAK input file**: * step_state: scheduled - **Step 13: Homozygous Read Coverage**: * step_state: scheduled - **Step 14: Genomescope Model Parameters**: * step_state: scheduled - **Step 15: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1**: * step_state: scheduled *
Jobs - **Job 1:** * Job state is ok **Command Line:** * ```console ln -f -s '/tmp/tmpr4264nk3/files/6/5/7/dataset_6575be2f-fd5b-48a8-8068-53e3a3b110f6.dat' 'yeast_reads_sub1_fastq_gz.fq.gz' && cutadapt -j=${GALAXY_SLOTS:-4} -b 'ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT' -b 'ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT' --error-rate=0.1 --times=1 --overlap=35 --action=trim --rc --discard-trimmed --minimum-length=1 --json=stats.json -o 'out1.fq.gz' 'yeast_reads_sub1_fastq_gz.fq.gz' > report.txt ``` **Exit Code:** * ```console 0 ``` **Traceback:** * ```console ``` **Job Parameters:** * | Job parameter | Parameter value | | ------------- | --------------- | | \_\_input\_ext | ` "input" ` | | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` | | adapter\_options | ` {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "35", "revcomp": true, "times": "1"} ` | | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` | | dbkey | ` "?" ` | | filter\_options | ` {"discard_casava": false, "discard_trimmed": true, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"} ` | | library | ` {"__current_case__": 0, "input_1": {"values": [{"id": 3, "src": "dce"}]}, "r1": {"adapters": [], "anywhere_adapters": [{"__index__": 0, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCAACAACAACAACGGAGGAGGAGGAAAAGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}, {"__index__": 1, "adapter_source": {"__current_case__": 0, "adapter": "ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT", "adapter_name": "", "adapter_source_list": "user"}, "single_noindels": false}], "front_adapters": []}, "type": "single"} ` | | other\_trimming\_options | ` {"cut": "0", "cut2": "0", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false} ` | | output\_selector | ` ["report", "json_stats"] ` | | read\_mod\_options | ` {"length_tag": "", "rename": "", "strip_suffix": "", "zero_cap": false} ` | 
 - **Step 16: \_\_SORTLIST\_\_**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | input | ` {"values": [{"id": 1, "src": "hdca"}]} ` |
             | sort\_type | ` {"__current_case__": 0, "sort_type": "alpha"} ` |

      </details>

 - **Step 17: \_\_SORTLIST\_\_**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | input | ` {"values": [{"id": 2, "src": "hdca"}]} ` |
             | sort\_type | ` {"__current_case__": 0, "sort_type": "alpha"} ` |

      </details>

 - **Step 18: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_grep\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           grep -G -A 0 -B 0 --no-group-separator  -i -- 'Haploid' '/tmp/tmpr4264nk3/files/6/3/f/dataset_63f03ac2-6fa7-4b21-aee0-0ea90bb4ec98.dat' > '/tmp/tmpr4264nk3/job_working_directory/000/10/outputs/dataset_916b900f-135a-46cb-afa1-2391eaecedeb.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | case\_sensitive | ` "-i" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | color | ` "NOCOLOR" ` |
             | dbkey | ` "?" ` |
             | invert | ` "" ` |
             | lines\_after | ` "0" ` |
             | lines\_before | ` "0" ` |
             | regex\_type | ` "-G" ` |
             | url\_paste | ` "Haploid" ` |

      </details>

 - **Step 19: pick\_value**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "data" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | style\_cond | ` {"__current_case__": 1, "pick_style": "first_or_default", "type_cond": {"__current_case__": 1, "default_value": "37", "param_type": "integer", "pick_from": [{"__index__": 0, "value": "32"}]}} ` |

      </details>

 - **Step 20: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types float,float,float,float,float,int  --file '/tmp/tmpr4264nk3/job_working_directory/000/12/configs/tmpdb2_urw8' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpr4264nk3/files/3/b/2/dataset_3b2bd55e-4f3d-47d9-934b-7785dfbc97b2.dat' '/tmp/tmpr4264nk3/job_working_directory/000/12/outputs/dataset_68e7272b-0394-4a6a-9c1f-3dc1a17fe81e.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           c3*2
           Computing 1 new columns with instructions ['c3*2;;']
           Computed new column values for 100.00% of 1 lines written.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | avoid\_scientific\_notation | ` false ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
             | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3*2"}], "header_lines_select": "no"} ` |

      </details>

 - **Step 3: Collection of Hi-C Forward reads**:

    * step_state: scheduled

 - **Step 21: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           die() { echo "$@" 1>&2 ; exit 1; } &&  mkdir multiqc_WDir &&   mkdir multiqc_WDir/cutadapt_0 &&     ln -s '/tmp/tmpr4264nk3/files/b/6/2/dataset_b623a6f8-e263-4918-aa96-866cdcbd3fe4.dat' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && sed -i.old 's/You are running/This is/' 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' && grep -q "This is cutadapt" 'multiqc_WDir/cutadapt_0/yeast_reads_sub1_fastq_gz.txt' || die "'This is cutadapt' or 'You are running cutadapt' not found in the file" &&   multiqc multiqc_WDir --filename 'report'       && mkdir -p ./plots && ls -l ./report_data/ && cp ./report_data/*plot*.txt ./plots/ | true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console

           /// MultiQC 🔍 v1.24.1

                version_check | MultiQC Version v1.25.1 now available!
                  file_search | Search path: /tmp/tmpr4264nk3/job_working_directory/000/13/working/multiqc_WDir

                     cutadapt | Found 1 reports

                write_results | Data        : report_data
                write_results | Report      : report.html
                      multiqc | MultiQC complete

           ```
        **Standard Output:**

         * ```console
           total 72
           -rw-r--r-- 1 1001 127    93 Oct 23 19:57 cutadapt_filtered_reads_plot.txt
           -rw-r--r-- 1 1001 127    66 Oct 23 19:57 cutadapt_trimmed_sequences_plot_default_Counts.txt
           -rw-r--r-- 1 1001 127    70 Oct 23 19:57 cutadapt_trimmed_sequences_plot_default_Obs_Exp.txt
           -rw-r--r-- 1 1001 127   124 Oct 23 19:57 multiqc_citations.txt
           -rw-r--r-- 1 1001 127   222 Oct 23 19:57 multiqc_cutadapt.txt
           -rw-r--r-- 1 1001 127 39114 Oct 23 19:57 multiqc_data.json
           -rw-r--r-- 1 1001 127   105 Oct 23 19:57 multiqc_general_stats.txt
           -rw-r--r-- 1 1001 127    29 Oct 23 19:57 multiqc_software_versions.txt
           -rw-r--r-- 1 1001 127   194 Oct 23 19:57 multiqc_sources.txt

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | comment | ` "" ` |
             | dbkey | ` "?" ` |
             | export | ` false ` |
             | flat | ` false ` |
             | results | ` [{"__index__": 0, "software_cond": {"__current_case__": 5, "input": {"values": [{"id": 5, "src": "hdca"}]}, "software": "cutadapt"}}] ` |
             | saveLog | ` "false" ` |
             | title | ` "" ` |

      </details>

 - **Step 22: Hi-C Forward Reads**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           (   cat "/tmp/tmpr4264nk3/files/0/f/0/dataset_0f09e509-563a-45ac-bf54-27c09ac35527.dat" ;   ) > /tmp/tmpr4264nk3/job_working_directory/000/14/outputs/dataset_876b9dfd-386c-49cb-9efc-066a083bfc24.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filename | ` {"__current_case__": 1, "add_name": false} ` |
             | one\_header | ` false ` |

      </details>

 - **Step 23: Hi-C Reverse Reads**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           (   cat "/tmp/tmpr4264nk3/files/8/2/6/dataset_82651443-b021-47c6-9454-95e77e443f5d.dat" ;   ) > /tmp/tmpr4264nk3/job_working_directory/000/15/outputs/dataset_a637f5db-1f97-44b1-a6e7-55e684f84cb7.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filename | ` {"__current_case__": 1, "add_name": false} ` |
             | one\_header | ` false ` |

      </details>

 - **Step 24: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_replace\_in\_line/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed -r --sandbox -e 's/bp//g' -e 's/,//g' -e 's/([a-z])\s+([A-Z])/\1_\2/g' '/tmp/tmpr4264nk3/files/9/1/6/dataset_916b900f-135a-46cb-afa1-2391eaecedeb.dat' > '/tmp/tmpr4264nk3/job_working_directory/000/16/outputs/dataset_fc2aa356-e258-44c7-a7c7-1ce18e8ac7e6.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | replacements | ` [{"__index__": 0, "find_pattern": "bp", "replace_pattern": ""}, {"__index__": 1, "find_pattern": ",", "replace_pattern": ""}, {"__index__": 2, "find_pattern": "([a-z])\\s+([A-Z])", "replace_pattern": "\\1_\\2"}] ` |

      </details>

 - **Step 25: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmpr4264nk3/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpr4264nk3/files/6/8/e/dataset_68e7272b-0394-4a6a-9c1f-3dc1a17fe81e.dat' 'c7' T '/tmp/tmpr4264nk3/job_working_directory/000/17/outputs/dataset_2a704ee9-8983-436d-b6fe-86db92edcc45.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c7" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 26: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is skipped

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | adapter\_options | ` {"action": "trim", "error_rate": "0.1", "match_read_wildcards": false, "no_indels": false, "no_match_adapter_wildcards": true, "overlap": "3", "revcomp": false, "times": "1"} ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filter\_options | ` {"discard_casava": false, "discard_trimmed": false, "discard_untrimmed": false, "max_average_error_rate": null, "max_expected_errors": null, "max_n": null, "maximum_length": null, "maximum_length2": null, "minimum_length": "1", "minimum_length2": null, "pair_filter": "any"} ` |
             | library | ` {"__current_case__": 1, "input_1": {"values": [{"id": 17, "src": "hda"}]}, "input_2": {"values": [{"id": 18, "src": "hda"}]}, "pair_adapters": false, "r1": {"adapters": [], "anywhere_adapters": [], "front_adapters": []}, "r2": {"adapters2": [], "anywhere_adapters2": [], "front_adapters2": []}, "type": "paired"} ` |
             | other\_trimming\_options | ` {"cut": "5", "cut2": "5", "nextseq_trim": "0", "poly_a": false, "quality_cutoff": "0", "quality_cutoff2": "", "shorten_options": {"__current_case__": 1, "shorten_values": "False"}, "shorten_options_r2": {"__current_case__": 1, "shorten_values_r2": "False"}, "trim_n": false} ` |
             | output\_selector | ` None ` |
             | read\_mod\_options | ` {"length_tag": null, "rename": null, "strip_suffix": null, "zero_cap": false} ` |

      </details>

 - **Step 27: Convert characters1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python /tmp/tmpr4264nk3/galaxy-dev/tools/filters/convert_characters.py --strip --condense /tmp/tmpr4264nk3/files/f/c/2/dataset_fc2aa356-e258-44c7-a7c7-1ce18e8ac7e6.dat s /tmp/tmpr4264nk3/job_working_directory/000/18/outputs/dataset_16970eb6-0f8e-41ca-b5e8-06ae7bd0ad34.dat
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "txt" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | condense | ` true ` |
             | convert\_from | ` "s" ` |
             | dbkey | ` "?" ` |
             | strip | ` true ` |

      </details>

 - **Step 28: Estimated homozygous read coverage**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 29: Pick forward reads**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | style\_cond | ` {"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 25, "src": "hda"}]}}, {"__index__": 1, "value": {"values": [{"id": 17, "src": "hda"}]}}]}} ` |

      </details>

 - **Step 30: Pick reverse reads**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | style\_cond | ` {"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 4, "param_type": "data", "pick_from": [{"__index__": 0, "value": {"values": [{"id": 26, "src": "hda"}]}}, {"__index__": 1, "value": {"values": [{"id": 18, "src": "hda"}]}}]}} ` |

      </details>

 - **Step 4: Collection of Hi-C Reverse reads**:

    * step_state: scheduled

 - **Step 31: Cut1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/tmpr4264nk3/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpr4264nk3/files/1/6/9/dataset_16970eb6-0f8e-41ca-b5e8-06ae7bd0ad34.dat' 'c3' T '/tmp/tmpr4264nk3/job_working_directory/000/20/outputs/dataset_4cc2e09a-9a47-44a4-b665-159e60cc22bc.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | columnList | ` "c3" ` |
             | dbkey | ` "?" ` |
             | delimiter | ` "T" ` |

      </details>

 - **Step 32: Homozygous read coverage for Hifiasm**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | style\_cond | ` {"__current_case__": 0, "pick_style": "first", "type_cond": {"__current_case__": 1, "param_type": "integer", "pick_from": [{"__index__": 0, "value": null}, {"__index__": 1, "value": "21"}]}} ` |

      </details>

 - **Step 33: Estimated genome size**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cd ../; python _evaluate_expression_.py
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | param\_type | ` "integer" ` |
             | remove\_newlines | ` true ` |

      </details>

 - **Step 34: Hifiasm**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmpr4264nk3/files/0/4/1/dataset_041143af-82e9-4e07-a8d6-dedad20cc98d.dat' input_0.fastq.gz &&  mkdir HiCF HiCR && ln -s '/tmp/tmpr4264nk3/files/8/7/6/dataset_876b9dfd-386c-49cb-9efc-066a083bfc24.dat' ./HiCF/input_0.fastqsanger.gz &&  ln -s '/tmp/tmpr4264nk3/files/a/6/3/dataset_a637f5db-1f97-44b1-a6e7-55e684f84cb7.dat' ./HiCR/input_0.fastqsanger.gz &&  hifiasm -t ${GALAXY_SLOTS:-1} -o output -f 32 -a 4 -z 0 -m 10000000 -p 100000 -n 3 -x 0.8 -y 0.2   --hom-cov 21  --h1 './HiCF/input_0.fastqsanger.gz' --h2 './HiCR/input_0.fastqsanger.gz' --l-msjoin 500000   --primary input_0.fastq.gz 2> output.log  && mkdir noseq_files && mv *.noseq.gfa noseq_files
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "fastq.gz" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | advanced\_options | ` {"__current_case__": 0, "advanced_selector": "blank"} ` |
             | assembly\_options | ` {"__current_case__": 1, "adapter_length": "0", "assembly_selector": "set", "cleaning_rounds": "4", "disable_post_join": false, "hom_cov": "21", "ignore_error_corrected": false, "max_overlap": "0.8", "min_overlap": "0.2", "pop_contigs": "10000000", "pop_unitigs": "100000", "remove_tips": "3"} ` |
             | bins\_out | ` false ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | filter\_bits | ` "32" ` |
             | hic\_partition | ` {"__current_case__": 1, "f_perturb": null, "h1": {"values": [{"id": 27, "src": "hda"}]}, "h2": {"values": [{"id": 28, "src": "hda"}]}, "hic_partition_selector": "set", "l_msjoin": "500000", "n_perturb": null, "n_weight": null, "seed": null} ` |
             | log\_out | ` true ` |
             | mode | ` {"__current_case__": 0, "mode_selector": "standard", "reads": {"values": [{"id": 4, "src": "hdca"}]}} ` |
             | ont\_integration | ` {"__current_case__": 0, "ont_integration_selector": "blank"} ` |
             | purge\_options | ` {"__current_case__": 0, "purge_selector": "blank"} ` |
             | scaffolding\_options | ` {"__current_case__": 0, "scaffold_selector": "blank"} ` |

      </details>

 - **Step 35: Raw Unitig Image**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           ln -s '/tmp/tmpr4264nk3/files/1/8/f/dataset_18f9663c-f132-4565-9f58-71d421a63abc.dat' input.gfa &&  export QT_QPA_PLATFORM='offscreen' && Bandage image input.gfa 'out.png' --height '2000' --nodewidth '25.0'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | fontsize | ` None ` |
             | height | ` "2000" ` |
             | lengths | ` false ` |
             | names | ` false ` |
             | nodewidth | ` "25.0" ` |
             | output\_format | ` "png" ` |
             | width | ` None ` |

      </details>

 - **Step 36: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpr4264nk3/files/7/b/2/dataset_7b28a532-ed25-4eeb-9507-74577ddf839c.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpr4264nk3/job_working_directory/000/28/outputs/dataset_66e08ebe-3435-4832-b7aa-6e6a6d4a452a.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 37: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpr4264nk3/files/f/9/2/dataset_f92819f8-5df4-4f65-9af1-591c2fe42406.dat' 2288021 --nstar-report --locale en_US.UTF-8 --discover-paths --tabular > '/tmp/tmpr4264nk3/job_working_directory/000/29/outputs/dataset_6155195e-6f58-420b-9c09-71a9b6cf3ee9.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": true, "selector": "statistics", "statistics_condition": {"__current_case__": 2, "expected_genomesize": "2288021", "selector": "assembly"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 38: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpr4264nk3/files/7/b/2/dataset_7b28a532-ed25-4eeb-9507-74577ddf839c.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpr4264nk3/job_working_directory/000/30/outputs/dataset_d04aecd7-1837-454a-b323-59f52d2fdc58.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 39: gfastats gfa hap2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpr4264nk3/files/7/b/2/dataset_7b28a532-ed25-4eeb-9507-74577ddf839c.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 40: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpr4264nk3/files/f/9/2/dataset_f92819f8-5df4-4f65-9af1-591c2fe42406.dat' --out-size c  --discover-paths --tabular > '/tmp/tmpr4264nk3/job_working_directory/000/32/outputs/dataset_f55184ed-8f92-4a7f-ab0c-8fd5e773f103.dat' --threads ${GALAXY_SLOTS:-8}
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 1, "discover_paths": true, "locale": false, "selector": "statistics", "statistics_condition": {"__current_case__": 0, "out_size": "c", "selector": "size"}, "tabular": true} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 5: Genomescope Summary**:

    * step_state: scheduled

 - **Step 41: gfastats gfa hap1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpr4264nk3/files/f/9/2/dataset_f92819f8-5df4-4f65-9af1-591c2fe42406.dat' --discover-paths  -o dataset.gfa --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 4, "out_format": "gfa", "terminal_overlaps_condition": {"__current_case__": 0, "terminal_overlaps_select": "no"}}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 42: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpr4264nk3/files/7/b/2/dataset_7b28a532-ed25-4eeb-9507-74577ddf839c.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 35
           Total scaffold length: 1008829
           Average scaffold length: 28823.69
           Scaffold N50: 24719
           Scaffold auN: 47664.45
           Scaffold L50: 10
           Largest scaffold: 132637
           Smallest scaffold: 11730
           # contigs: 35
           Total contig length: 1008829
           Average contig length: 28823.69
           Contig N50: 24719
           Contig auN: 47664.45
           Contig L50: 10
           Largest contig: 132637
           Smallest contig: 11730
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 303859:199058:199884:306028
           GC content %: 39.55
           # soft-masked bases: 0
           # segments: 35
           Total segment length: 1008829
           Average segment length: 28823.69
           # gaps: 0
           # paths: 35

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 43: toolshed.g2.bx.psu.edu/repos/bgruening/gfastats/gfastats/1.3.8+galaxy0**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           gfastats '/tmp/tmpr4264nk3/files/f/9/2/dataset_f92819f8-5df4-4f65-9af1-591c2fe42406.dat' --discover-paths  -o dataset.fasta --threads ${GALAXY_SLOTS:-8} && mv dataset* output_dataset
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Output:**

         * ```console
           +++Assembly summary+++: 
           # scaffolds: 72
           Total scaffold length: 1778748
           Average scaffold length: 24704.83
           Scaffold N50: 22121
           Scaffold auN: 35945.06
           Scaffold L50: 25
           Largest scaffold: 132637
           Smallest scaffold: 11410
           # contigs: 72
           Total contig length: 1778748
           Average contig length: 24704.83
           Contig N50: 22121
           Contig auN: 35945.06
           Contig L50: 25
           Largest contig: 132637
           Smallest contig: 11410
           # gaps in scaffolds: 0
           Total gap length in scaffolds: 0
           Average gap length in scaffolds: 0.00
           Gap N50 in scaffolds: 0
           Gap auN in scaffolds: 0.00
           Gap L50 in scaffolds: 0
           Largest gap in scaffolds: 0
           Smallest gap in scaffolds: 0
           Base composition (A:C:G:T): 543138:342989:347557:545064
           GC content %: 38.82
           # soft-masked bases: 0
           # segments: 72
           Total segment length: 1778748
           Average segment length: 24704.83
           # gaps: 0
           # paths: 72

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | mode\_condition | ` {"__current_case__": 0, "discover_paths": true, "homopolymer_compress": null, "output_condition": {"__current_case__": 0, "line_length": null, "out_format": "fasta"}, "remove_terminal_gaps": false, "selector": "manipulation", "sort": "", "swiss_army_knife": null} ` |
             | target\_condition | ` {"__current_case__": 0, "target_option": "false"} ` |

      </details>

 - **Step 44: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmpr4264nk3/job_working_directory/000/36/configs/tmpqcyszxz2' '/tmp/tmpr4264nk3/files/6/6/e/dataset_66e08ebe-3435-4832-b7aa-6e6a6d4a452a.dat' > '/tmp/tmpr4264nk3/job_working_directory/000/36/outputs/dataset_e2dd632c-c04d-42ac-a796-b1b7bded9817.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap2\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 45: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           env -i $(which awk) --sandbox -v FS='    ' -v OFS='  ' --re-interval -f '/tmp/tmpr4264nk3/job_working_directory/000/37/configs/tmptu2wl72j' '/tmp/tmpr4264nk3/files/6/1/5/dataset_6155195e-6f58-420b-9c09-71a9b6cf3ee9.dat' > '/tmp/tmpr4264nk3/job_working_directory/000/37/outputs/dataset_40e55c4e-463a-416f-ac32-b80413f02b60.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "BEGIN{print \"Metric\\thap1\"}; {print}; " ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 46: Data Prep Hap2**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmpr4264nk3/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpr4264nk3/files/d/0/4/dataset_d04aecd7-1837-454a-b323-59f52d2fdc58.dat' --output='/tmp/tmpr4264nk3/job_working_directory/000/38/outputs/dataset_f060fa92-74ff-4a85-9dcf-697b2bb4a30f.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ab917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmpr4264nk3/job_working_directory/000/39/configs/tmp0jx_9x5w' '/tmp/tmpr4264nk3/files/f/0/6/dataset_f060fa92-74ff-4a85-9dcf-697b2bb4a30f.dat' > '/tmp/tmpr4264nk3/job_working_directory/000/39/outputs/dataset_f4a201f9-5d1d-4f95-a532-6d5b68ae5faa.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ab917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmpr4264nk3/files/f/4/a/dataset_f4a201f9-5d1d-4f95-a532-6d5b68ae5faa.dat > '/tmp/tmpr4264nk3/job_working_directory/000/40/outputs/dataset_92977591-4d3f-4d64-a8be-3e758d39467b.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ab917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpr4264nk3/files/f/4/a/dataset_f4a201f9-5d1d-4f95-a532-6d5b68ae5faa.dat" "/tmp/tmpr4264nk3/job_working_directory/000/41/outputs/dataset_9d23ca25-a8f7-44b7-bee2-4c65968d87f4.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ab917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ab917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ab917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1008829", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpr4264nk3/job_working_directory/000/64/configs/tmpndmi153e' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpr4264nk3/files/9/d/2/dataset_9d23ca25-a8f7-44b7-bee2-4c65968d87f4.dat' '/tmp/tmpr4264nk3/job_working_directory/000/64/outputs/dataset_8cbc7068-c377-45e4-9dd9-565eba354a2a.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1008829
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1008829;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 35 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ab917811efaae797dc3d85d64d" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1008829"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 47: Data Prep Hap1**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: gfa_stats**:

         * step_state: scheduled

      - **Step 2: sort1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/tmpr4264nk3/galaxy-dev/tools/filters/sorter.py'  --input='/tmp/tmpr4264nk3/files/f/5/5/dataset_f55184ed-8f92-4a7f-ab0c-8fd5e773f103.dat' --output='/tmp/tmpr4264nk3/job_working_directory/000/43/outputs/dataset_5e0da490-d085-48b8-a4a7-769e9967c4de.dat'    --key=2,2nr   --header 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ac917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | column | ` "2" ` |
                  | column\_set | ` [] ` |
                  | dbkey | ` "?" ` |
                  | header\_lines | ` "0" ` |
                  | order | ` "DESC" ` |
                  | style | ` "num" ` |

           </details>

      - **Step 3: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_awk\_tool/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                env -i $(which awk) --sandbox -v FS='   ' -v OFS='  ' --re-interval -f '/tmp/tmpr4264nk3/job_working_directory/000/44/configs/tmp6na2to3g' '/tmp/tmpr4264nk3/files/5/e/0/dataset_5e0da490-d085-48b8-a4a7-769e9967c4de.dat' > '/tmp/tmpr4264nk3/job_working_directory/000/44/outputs/dataset_8b34ed76-de0b-447e-ab4f-b8c9735f3aa1.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ac917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | code | ` "{total += $2; $3 = total}1" ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 4: toolshed.g2.bx.psu.edu/repos/iuc/datamash\_ops/datamash\_ops/1.8+galaxy0**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                datamash         absmax 3 < /tmp/tmpr4264nk3/files/8/b/3/dataset_8b34ed76-de0b-447e-ab4f-b8c9735f3aa1.dat > '/tmp/tmpr4264nk3/job_working_directory/000/45/outputs/dataset_3336b571-5397-423f-9599-eedc5598c961.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ac917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | grouping | ` "" ` |
                  | header\_in | ` false ` |
                  | header\_out | ` false ` |
                  | ignore\_case | ` false ` |
                  | narm | ` false ` |
                  | need\_sort | ` false ` |
                  | operations | ` [{"__index__": 0, "op_column": "3", "op_name": "absmax"}] ` |
                  | print\_full\_line | ` false ` |

           </details>

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpr4264nk3/files/8/b/3/dataset_8b34ed76-de0b-447e-ab4f-b8c9735f3aa1.dat" "/tmp/tmpr4264nk3/job_working_directory/000/46/outputs/dataset_48fd1aec-aa3f-42d3-8b35-e34df115304e.dat" "1" "yes"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ac917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "1" ` |
                  | iterate | ` "yes" ` |

           </details>

      - **Step 6: param\_value\_from\_file**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ac917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | param\_type | ` "integer" ` |
                  | remove\_newlines | ` true ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/iuc/compose\_text\_param/compose\_text\_param/0.1.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cd ../; python _evaluate_expression_.py
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ac917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | components | ` [{"__index__": 0, "param_type": {"__current_case__": 0, "component_value": "c3/", "select_param_type": "text"}}, {"__index__": 1, "param_type": {"__current_case__": 1, "component_value": "1778748", "select_param_type": "integer"}}] ` |
                  | dbkey | ` "?" ` |

           </details>

      - **Step 8: toolshed.g2.bx.psu.edu/repos/devteam/column\_maker/Add\_a\_column1/2.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                python '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/column_maker/aff5135563c6/column_maker/column_maker.py' --column-types str,int,int,int  --file '/tmp/tmpr4264nk3/job_working_directory/000/65/configs/tmpb4968rxo' --fail-on-non-existent-columns --fail-on-non-computable '/tmp/tmpr4264nk3/files/4/8/f/dataset_48fd1aec-aa3f-42d3-8b35-e34df115304e.dat' '/tmp/tmpr4264nk3/job_working_directory/000/65/outputs/dataset_76684e73-1c3d-4eb5-ac14-ef60046dedf9.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Output:**

              * ```console
                c3/1778748
                c2/1000000
                c3/1000000
                Computing 3 new columns with instructions ['c3/1778748;;', 'c2/1000000;;', 'c3/1000000;;']
                Computed new column values for 100.00% of 72 lines written.

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ac917811efaae797dc3d85d64d" ` |
                  | avoid\_scientific\_notation | ` false ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | error\_handling | ` {"auto_col_types": true, "fail_on_non_existent_columns": true, "non_computable": {"__current_case__": 0, "action": "--fail-on-non-computable"}} ` |
                  | ops | ` {"__current_case__": 0, "expressions": [{"__index__": 0, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1778748"}, {"__index__": 1, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c2/1000000"}, {"__index__": 2, "add_column": {"__current_case__": 0, "mode": "", "pos": ""}, "cond": "c3/1000000"}], "header_lines_select": "no"} ` |

           </details>
       </details>

 - **Step 48: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmpr4264nk3/job_working_directory/000/48/configs/tmp6z0faew4' '/tmp/tmpr4264nk3/files/0/7/f/dataset_07f4766c-e448-49f7-9e03-2fecad1e0269.dat' > '/tmp/tmpr4264nk3/job_working_directory/000/48/outputs/dataset_cedbc720-63ae-4e93-8036-a363b0d8697b.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 49: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_sed\_tool/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           sed --sandbox -r -f '/tmp/tmpr4264nk3/job_working_directory/000/49/configs/tmpqx7t3jlh' '/tmp/tmpr4264nk3/files/6/8/c/dataset_68cf64b8-8339-40a8-8714-887ec274f649.dat' > '/tmp/tmpr4264nk3/job_working_directory/000/49/outputs/dataset_861177db-ae02-4ef5-93a3-7ab31ec6c515.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | adv\_opts | ` {"__current_case__": 0, "adv_opts_selector": "basic"} ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | code | ` "s/_path//g" ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 50: join1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           python '/tmp/tmpr4264nk3/galaxy-dev/tools/filters/join.py' '/tmp/tmpr4264nk3/files/4/0/e/dataset_40e55c4e-463a-416f-ac32-b80413f02b60.dat' '/tmp/tmpr4264nk3/files/e/2/d/dataset_e2dd632c-c04d-42ac-a796-b1b7bded9817.dat' 1 1 '/tmp/tmpr4264nk3/job_working_directory/000/50/outputs/dataset_777eb96a-a265-47af-bb0c-b287f2ebe879.dat' -u -p --index_depth=3 --buffer=50000000 --fill_options_file=/tmp/tmpr4264nk3/job_working_directory/000/50/configs/tmpid6n4sfz
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "tabular" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | field1 | ` "1" ` |
             | field2 | ` "1" ` |
             | fill\_empty\_columns | ` {"__current_case__": 1, "do_fill_empty_columns": {"__current_case__": 0, "column_fill_type": "single_fill_value", "fill_value": "."}, "fill_columns_by": "fill_unjoined_only", "fill_empty_columns_switch": "fill_empty"} ` |
             | header | ` "" ` |
             | partial | ` "-p" ` |
             | unmatched | ` "-u" ` |

      </details>

 - **Step 6: Meryl Database**:

    * step_state: scheduled

 - **Step 51: Plot Data**:

    * step_state: scheduled

    * <details><summary>Subworkflow Steps</summary>

      - **Step 1: Primary data**:

         * step_state: scheduled

      - **Step 2: Alternate data**:

         * step_state: scheduled

      - **Step 11: Size Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpr4264nk3/job_working_directory/000/72/configs/tmp6md20x5o' && Rscript '/tmp/tmpr4264nk3/job_working_directory/000/72/configs/tmp6md20x5o'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmpr4264nk3/files/6/d/f/dataset_6dfc9ae8-9e2f-40cf-acf9-198653d8d67c.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('Scaffold number') + ylab('Cumulative Size (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmpr4264nk3/job_working_directory/000/72/outputs/dataset_e2358408-a419-4637-890d-6537f6f57f4b.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ad917811efaae797dc3d85d64d" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "Scaffold number" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Cumulative Size (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>

      - **Step 3: Name of primary assembly**:

         * step_state: scheduled

      - **Step 4: Name of alternate assembly**:

         * step_state: scheduled

      - **Step 5: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpr4264nk3/files/7/6/6/dataset_76684e73-1c3d-4eb5-ac14-ef60046dedf9.dat" "/tmp/tmpr4264nk3/job_working_directory/000/66/outputs/dataset_c339c828-bb05-42c4-86d7-d9e175295c44.dat" "Hap1" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ad917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap1" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 6: toolshed.g2.bx.psu.edu/repos/devteam/add\_value/addValue/1.0.1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl /tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/devteam/add_value/023f0a3760b3/add_value/fixedValueColumn.pl "/tmp/tmpr4264nk3/files/8/c/b/dataset_8cbc7068-c377-45e4-9dd9-565eba354a2a.dat" "/tmp/tmpr4264nk3/job_working_directory/000/67/outputs/dataset_5007e654-830d-42ec-846c-57287b4368e1.dat" "Hap2" "no"
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ad917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | exp | ` "Hap2" ` |
                  | iterate | ` "no" ` |

           </details>

      - **Step 7: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cat/9.3+galaxy1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpr4264nk3/files/c/3/3/dataset_c339c828-bb05-42c4-86d7-d9e175295c44.dat' >> '/tmp/tmpr4264nk3/job_working_directory/000/68/outputs/dataset_4538a143-9595-4cd8-9990-209999992c38.dat' && cat '/tmp/tmpr4264nk3/files/5/0/0/dataset_5007e654-830d-42ec-846c-57287b4368e1.dat' >> '/tmp/tmpr4264nk3/job_working_directory/000/68/outputs/dataset_4538a143-9595-4cd8-9990-209999992c38.dat' && exit 0
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ad917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | queries | ` [{"__index__": 0, "inputs2": {"values": [{"id": 114, "src": "hda"}]}}] ` |

           </details>

      - **Step 8: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmpr4264nk3/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpr4264nk3/files/4/5/3/dataset_4538a143-9595-4cd8-9990-209999992c38.dat' 'c8,c5,c6' T '/tmp/tmpr4264nk3/job_working_directory/000/69/outputs/dataset_b47a3391-e3ef-40cb-8ab2-15814d798b3f.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ad917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c5,c6" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 9: Cut1**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                perl '/tmp/tmpr4264nk3/galaxy-dev/tools/filters/cutWrapper.pl' '/tmp/tmpr4264nk3/files/4/5/3/dataset_4538a143-9595-4cd8-9990-209999992c38.dat' 'c8,c4,c7' T '/tmp/tmpr4264nk3/job_working_directory/000/70/outputs/dataset_6dfc9ae8-9e2f-40cf-acf9-198653d8d67c.dat'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "tabular" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ad917811efaae797dc3d85d64d" ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | columnList | ` "c8,c4,c7" ` |
                  | dbkey | ` "?" ` |
                  | delimiter | ` "T" ` |

           </details>

      - **Step 10: Nx Plot**:

         * step_state: scheduled

         * <details><summary>Jobs</summary>

           - **Job 1:**

             * Job state is ok

             **Command Line:**

              * ```console
                cat '/tmp/tmpr4264nk3/job_working_directory/000/71/configs/tmp5wo0nrue' && Rscript '/tmp/tmpr4264nk3/job_working_directory/000/71/configs/tmp5wo0nrue'
                ```
             **Exit Code:**

              * ```console
                0
                ```
             **Standard Error:**

              * ```console
                Warning message:
                In Sys.setlocale("LC_MESSAGES", "en_US.UTF-8") :
                  OS reports request to set locale to "en_US.UTF-8" cannot be honored
                Warning message:
                package ‘ggplot2’ was built under R version 4.1.3 
                Warning message:
                Using `size` aesthetic for lines was deprecated in ggplot2 3.4.0.
                ℹ Please use `linewidth` instead. 

                ```
             **Standard Output:**

              * ```console

                        options(show.error.messages=F, error=function(){cat(geterrmessage(), file=stderr()); q("no",1,F)})

                        loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")

                library(ggplot2)

                        #Choose between automatically scaled x and y axis or user defined
                            gg_scalex = NULL
                            gg_scaley = NULL

                            gg_theme = theme_bw()

                            gg_legend = theme(legend.position="right")

                input <- read.csv('/tmp/tmpr4264nk3/files/b/4/7/dataset_b47a3391-e3ef-40cb-8ab2-15814d798b3f.dat', sep='\t', header=TRUE)

                names(input)[2] <- "xcol"
                names(input)[3] <- "ycol"

                    gg_facet = NULL
                    gg_factor = aes(colour=factor(factor))

                        gg_line = geom_line(size=1, alpha=1, gg_factor)

                        color_scale = scale_color_brewer(palette='Set1', direction='1')

                    names(input)[1] <- "factor"

                    gg_axistitle = theme(axis.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_axistext = theme(axis.text = element_text(color = NULL, size = NULL, face = NULL))

                    gg_plottitle = theme(plot.title = element_text(color = NULL, size = NULL, face = NULL))

                    gg_gridline = NULL

                    gg_point = NULL

                #this is the actual ggplot command to make the final plot(s)
                plot_out <- ggplot(input, aes(xcol, ycol)) + gg_point + gg_line + gg_facet +
                    gg_theme + gg_scalex + gg_scaley + color_scale + gg_legend + ggtitle('') + xlab('x') + ylab('Nx (Mb)')+
                    gg_axistitle + gg_axistext + gg_plottitle + gg_gridline

                        gg_width <- as.double('6.0')
                        gg_height <- as.double('4.0')
                        gg_unit <- 'in'
                        gg_dpi <- as.double('300.0')
                        gg_add_device <- 'none'
                        output1 <- '/tmp/tmpr4264nk3/job_working_directory/000/71/outputs/dataset_4859efbf-34bf-42c9-bfc5-47ffa34f5788.dat'
                        output2 <- 'XXXX'

                        ggsave(filename = output1, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = "png")
                        if(gg_add_device != "none"){
                          ggsave(filename = output2, plot = plot_out, width = gg_width, height = gg_height, units = gg_unit, dpi = gg_dpi, device = gg_add_device)
                        }

                ```
             **Traceback:**

              * ```console

                ```
             **Job Parameters:**

              *   | Job parameter | Parameter value |
                  | ------------- | --------------- |
                  | \_\_input\_ext | ` "input" ` |
                  | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167ad917811efaae797dc3d85d64d" ` |
                  | adv | ` {"axis_text_customization": {"__current_case__": 0, "axis_customization": "default"}, "axis_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "factor": {"__current_case__": 1, "colororder": "1", "colors": "Set1", "factorcol": "1", "factoring": "Single"}, "gridlinecust": "default", "legend": "yes", "plot_title_customization": {"__current_case__": 0, "axis_customization": "default"}, "scaling": {"__current_case__": 0, "plot_scaling": "Automatic"}, "theme": "bw", "transform": "none", "type_conditional": {"__current_case__": 2, "type_options": "lines"}} ` |
                  | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
                  | dbkey | ` "?" ` |
                  | out | ` {"additional_output_format": "none", "dpi_output_dim": "300.0", "height_output_dim": "4.0", "unit_output_dim": "in", "width_output_dim": "6.0"} ` |
                  | title | ` "" ` |
                  | xlab | ` "x" ` |
                  | xplot | ` "2" ` |
                  | ylab | ` "Nx (Mb)" ` |
                  | yplot | ` "3" ` |

           </details>
       </details>

 - **Step 52: Busco Hap2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmpr4264nk3/files/c/e/d/dataset_cedbc720-63ae-4e93-8036-a363b0d8697b.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-10-23 20:15:14 ERROR:   Something went wrong. Results not recorded.
           2024-10-23 20:15:14 ERROR:   BUSCO analysis failed!
           2024-10-23 20:15:14 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-10-23 20:04:21 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 10/23/2024 20:04:21 *****
           2024-10-23 20:04:21 INFO:    Configuring BUSCO with local environment
           2024-10-23 20:04:21 INFO:    Running genome mode
           2024-10-23 20:04:25 INFO:    Input file is /tmp/tmpr4264nk3/files/c/e/d/dataset_cedbc720-63ae-4e93-8036-a363b0d8697b.dat
           2024-10-23 20:04:25 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 20:04:25 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 20:04:25 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-10-23 20:04:25 INFO:    Running 1 job(s) on bbtools, starting at 10/23/2024 20:04:25
           2024-10-23 20:04:27 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-10-23 20:04:27 INFO:    Running 1 job(s) on miniprot_index, starting at 10/23/2024 20:04:27
           2024-10-23 20:04:28 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-10-23 20:04:28 INFO:    Running 1 job(s) on miniprot_align, starting at 10/23/2024 20:04:28
           2024-10-23 20:14:37 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-10-23 20:14:40 INFO:    ***** Run HMMER on gene sequences *****
           2024-10-23 20:14:40 INFO:    Running 395 job(s) on hmmsearch, starting at 10/23/2024 20:14:40
           2024-10-23 20:14:45 INFO:    [hmmsearch] 40 of 395 task(s) completed
           2024-10-23 20:14:48 INFO:    [hmmsearch] 79 of 395 task(s) completed
           2024-10-23 20:14:52 INFO:    [hmmsearch] 119 of 395 task(s) completed
           2024-10-23 20:14:55 INFO:    [hmmsearch] 158 of 395 task(s) completed
           2024-10-23 20:14:58 INFO:    [hmmsearch] 198 of 395 task(s) completed
           2024-10-23 20:15:01 INFO:    [hmmsearch] 237 of 395 task(s) completed
           2024-10-23 20:15:04 INFO:    [hmmsearch] 277 of 395 task(s) completed
           2024-10-23 20:15:07 INFO:    [hmmsearch] 316 of 395 task(s) completed
           2024-10-23 20:15:10 INFO:    [hmmsearch] 356 of 395 task(s) completed
           2024-10-23 20:15:13 INFO:    [hmmsearch] 395 of 395 task(s) completed
           2024-10-23 20:15:13 INFO:    21 exons in total
           2024-10-23 20:15:13 WARNING: 1 of 16 Complete matches (6.2%) contain internal stop codons in Miniprot gene predictions

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 53: Merqury**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           mkdir -p output_files && mkdir -p read-db.meryl && tar -zxf /tmp/tmpr4264nk3/files/b/c/2/dataset_bc29428e-f540-4aa0-a9bc-d658125ef6d0.dat -C read-db.meryl --strip-components=1 && ln -s '/tmp/tmpr4264nk3/files/8/6/1/dataset_861177db-ae02-4ef5-93a3-7ab31ec6c515.dat' assembly_01.fasta && ln -s '/tmp/tmpr4264nk3/files/c/e/d/dataset_cedbc720-63ae-4e93-8036-a363b0d8697b.dat' assembly_02.fasta && merqury.sh read-db.meryl assembly_01.fasta assembly_02.fasta output_merqury &> /tmp/tmpr4264nk3/job_working_directory/000/52/outputs/dataset_8fc73c6a-1095-4edc-95b0-562d3dea62cd.dat && mv output_merqury* output_files && find . -maxdepth 1 -name 'assembly_only*' -type f -print0 | xargs -0r mv -t output_files  && sed -i '1s/^/assembly\tk-mer set\tsolid k-mers in assembly\tsolid k-mers in reads\tcompleteness %\n/' 'output_files/output_merqury.completeness.stats' && sed -i '1s/^/assembly\tunique k-mers\tcommon k-mers\tQV\terror rate\n/' 'output_files/output_merqury.qv'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | label | ` "output_merqury" ` |
             | mode | ` {"__current_case__": 0, "assembly_options": {"__current_case__": 1, "assembly_01": {"values": [{"id": 58, "src": "hda"}]}, "assembly_02": {"values": [{"id": 57, "src": "hda"}]}, "number_assemblies": "two"}, "meryldb_F1": {"values": [{"id": 5, "src": "hda"}]}, "options": "default"} ` |
             | output\_add\_headers | ` true ` |
             | output\_selector | ` ["qv", "plots", "stats", "log", "hist"] ` |

      </details>

 - **Step 54: Busco Hap1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           busco --in '/tmp/tmpr4264nk3/files/8/6/1/dataset_861177db-ae02-4ef5-93a3-7ab31ec6c515.dat' --mode 'geno' --out busco_galaxy --cpu ${GALAXY_SLOTS:-4} --evalue 0.001 --limit 3 --contig_break 10  --offline --download_path /cvmfs/data.galaxyproject.org/byhand/busco/v5  --lineage_dataset 'vertebrata_odb10'  --miniprot  && mkdir BUSCO_summaries && ls -l busco_galaxy/run_*/ && cp busco_galaxy/short_summary.*.txt BUSCO_summaries/ && generate_plot.py -wd BUSCO_summaries -rt specific  && echo "##gff-version 3" > busco_output.gff && cat busco_galaxy/run_*/busco_sequences/*busco_sequences/*.gff >> busco_output.gff 2> /dev/null || true
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Standard Error:**

         * ```console
           2024-10-23 20:21:23 ERROR:   Something went wrong. Results not recorded.
           2024-10-23 20:21:23 ERROR:   BUSCO analysis failed!
           2024-10-23 20:21:23 ERROR:   Check the logs, read the user guide (https://busco.ezlab.org/busco_userguide.html), and check the BUSCO issue board on https://gitlab.com/ezlab/busco/issues

           ```
        **Standard Output:**

         * ```console
           2024-10-23 20:04:21 INFO:    ***** Start a BUSCO v5.7.1 analysis, current time: 10/23/2024 20:04:21 *****
           2024-10-23 20:04:21 INFO:    Configuring BUSCO with local environment
           2024-10-23 20:04:21 INFO:    Running genome mode
           2024-10-23 20:04:25 INFO:    Input file is /tmp/tmpr4264nk3/files/8/6/1/dataset_861177db-ae02-4ef5-93a3-7ab31ec6c515.dat
           2024-10-23 20:04:25 WARNING: Option evalue was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 20:04:25 WARNING: Option limit was provided but is not used in the selected run mode, euk_genome_min
           2024-10-23 20:04:25 INFO:    Running BUSCO using lineage dataset vertebrata_odb10 (eukaryota, 2021-02-19)
           2024-10-23 20:04:25 INFO:    Running 1 job(s) on bbtools, starting at 10/23/2024 20:04:25
           2024-10-23 20:04:27 INFO:    [bbtools]   1 of 1 task(s) completed
           2024-10-23 20:04:27 INFO:    Running 1 job(s) on miniprot_index, starting at 10/23/2024 20:04:27
           2024-10-23 20:04:28 INFO:    [miniprot_index]    1 of 1 task(s) completed
           2024-10-23 20:04:28 INFO:    Running 1 job(s) on miniprot_align, starting at 10/23/2024 20:04:28
           2024-10-23 20:20:48 INFO:    [miniprot_align]    1 of 1 task(s) completed
           2024-10-23 20:20:54 INFO:    ***** Run HMMER on gene sequences *****
           2024-10-23 20:20:55 INFO:    Running 584 job(s) on hmmsearch, starting at 10/23/2024 20:20:55
           2024-10-23 20:20:59 INFO:    [hmmsearch] 59 of 584 task(s) completed
           2024-10-23 20:21:02 INFO:    [hmmsearch] 117 of 584 task(s) completed
           2024-10-23 20:21:05 INFO:    [hmmsearch] 176 of 584 task(s) completed
           2024-10-23 20:21:07 INFO:    [hmmsearch] 234 of 584 task(s) completed
           2024-10-23 20:21:10 INFO:    [hmmsearch] 292 of 584 task(s) completed
           2024-10-23 20:21:13 INFO:    [hmmsearch] 351 of 584 task(s) completed
           2024-10-23 20:21:15 INFO:    [hmmsearch] 409 of 584 task(s) completed
           2024-10-23 20:21:17 INFO:    [hmmsearch] 468 of 584 task(s) completed
           2024-10-23 20:21:20 INFO:    [hmmsearch] 526 of 584 task(s) completed
           2024-10-23 20:21:23 INFO:    [hmmsearch] 584 of 584 task(s) completed
           2024-10-23 20:21:23 INFO:    42 exons in total
           2024-10-23 20:21:23 WARNING: 2 of 33 Complete matches (6.1%) contain internal stop codons in Miniprot gene predictions
           2024-10-23 20:21:23 WARNING: BUSCO gene predictions from Miniprot have low average identity (0.4399999976158142). You may want to repeat the analysis using the Metaeuk pipeline.

           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | adv | ` {"contig_break": "10", "evalue": "0.001", "limit": "3"} ` |
             | busco\_mode | ` {"__current_case__": 0, "mode": "geno", "use_augustus": {"__current_case__": 1, "use_augustus_selector": "miniprot"}} ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | lineage | ` {"__current_case__": 1, "lineage_dataset": "vertebrata_odb10", "lineage_mode": "select_lineage"} ` |
             | lineage\_conditional | ` {"__current_case__": 0, "cached_db": "v5", "selector": "cached"} ` |
             | outputs | ` ["short_summary", "missing", "image", "gff"] ` |

      </details>

 - **Step 55: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_cut\_tool/9.3+galaxy2**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           cut --complement -f '3' '/tmp/tmpr4264nk3/files/7/7/7/dataset_777eb96a-a265-47af-bb0c-b287f2ebe879.dat' > '/tmp/tmpr4264nk3/job_working_directory/000/54/outputs/dataset_96aad39c-9f4b-4534-8569-3169dabc9187.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | complement | ` "--complement" ` |
             | cut\_type\_options | ` {"__current_case__": 0, "colnames_option": {"__current_case__": 1, "header": "N", "list": ["3"]}, "cut_element": "-f", "delimiter": ""} ` |
             | dbkey | ` "?" ` |

      </details>

 - **Step 56: output_merqury.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 57: output_merqury.spectra-asm.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.spectra-asm.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 58: merqury_qv**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | input | ` {"values": [{"id": 10, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 59: output_merqury.assembly_01.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_01.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 60: merqury_stats**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | input | ` {"values": [{"id": 12, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.completeness", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 7: Database for Busco Lineage**:

    * step_state: scheduled

 - **Step 61: output_merqury.assembly_02.spectra-cn.fl**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | input | ` {"values": [{"id": 11, "src": "hdca"}]} ` |
             | which | ` {"__current_case__": 1, "identifier": "output_merqury.assembly_02.spectra-cn.fl", "which_dataset": "by_identifier"} ` |

      </details>

 - **Step 62: toolshed.g2.bx.psu.edu/repos/bgruening/text\_processing/tp\_find\_and\_replace/9.3+galaxy1**:

    * step_state: scheduled

    * <details><summary>Jobs</summary>

      - **Job 1:**

        * Job state is ok

        **Command Line:**

         * ```console
           perl '/tmp/shed_dir/toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/86755160afbf/text_processing/find_and_replace' -o '/tmp/tmpr4264nk3/job_working_directory/000/55/outputs/dataset_4bf68055-92d9-4683-8d91-d14515f57b61.dat' -g     '#' 'Number of' '/tmp/tmpr4264nk3/files/9/6/a/dataset_96aad39c-9f4b-4534-8569-3169dabc9187.dat'
           ```
        **Exit Code:**

         * ```console
           0
           ```
        **Traceback:**

         * ```console

           ```
        **Job Parameters:**

         *   | Job parameter | Parameter value |
             | ------------- | --------------- |
             | \_\_input\_ext | ` "input" ` |
             | \_\_workflow\_invocation\_uuid\_\_ | ` "bff167aa917811efaae797dc3d85d64d" ` |
             | chromInfo | ` "/tmp/tmpr4264nk3/galaxy-dev/tool-data/shared/ucsc/chrom/?.len" ` |
             | dbkey | ` "?" ` |
             | find\_and\_replace | ` [{"__index__": 0, "caseinsensitive": false, "find_pattern": "#", "global": true, "is_regex": false, "replace_pattern": "Number of", "searchwhere": {"__current_case__": 0, "searchwhere_select": "line"}, "skip_first_line": false, "wholewords": false}] ` |

      </details>

 - **Step 8: Lineage**:

    * step_state: scheduled

 - **Step 9: Name for Haplotype 1**:

    * step_state: scheduled

 - **Step 10: Name for Haplotype 2**:

    * step_state: scheduled

  </details>
  • Other invocation details - **history_id** * c25b453875fda48e - **history_state** * ok - **invocation_id** * c25b453875fda48e - **invocation_state** * scheduled - **workflow_id** * b8631724f99938eb

gxydevbot commented 2 days ago

There are new updates, if you want to integrate them, close the PR and delete branch.