search

genetic-tools / primerbench

0 stars 0 forks source link

Alignment of TCGGTCCCTTTGGTACGAAA #14

Closed AnCaTjin closed 6 years ago

AnCaTjin commented 6 years ago

So, I dare to create a new issue, I'm not sure about the style. We agree this sequence is not getting perfect matches. But https://genetic.tools/en/primers/123/reverse/ has the same sequence and gets 8 hits. When I added the sequence again Test_X, I realised the primer was imported in reverse complement.

GaretJax commented 6 years ago

(style is perfect like this)

There is certainly some ambiguity here in how the sequences were added. Maybe something changed between the time you added the first and the second primers.

What would be the expected behavior? Am I correct assuming that a primer would match in both directions?

AnCaTjin commented 6 years ago

Yes and no. The primer can of course match on both strangs, but the primer orientation is important for the amplification.

AnCaTjin commented 6 years ago

What ist you input for the blast search of F:GGACATACGACACCTCCACC R:TCGGTCCCTTTGGTACGAAA ? I think there is a mistake, when I import a single primer. The sequences are turned. (see test_zfyve26)

AnCaTjin commented 6 years ago

That is probably just the way the sequence is displayed in the primerbench/primer overview.

GaretJax commented 6 years ago

Yes, it is reversed there because it matches on the - strand. SNPCheck yields the same results:

Sample input: AGRN_Ex1 GTCCCGGGGCTTTGTTCG CGAGGTGCACTTGTCTCCG 1

image

image

Results: https://secure.ngrl.org.uk/SNPCheck/retrieve_results.htm?batchId=d197bb305f9b90b501618ec43b7b3b27

AnCaTjin commented 6 years ago

primer_orientierung

AnCaTjin commented 6 years ago

I assumed the sequences displayed at "my primers" were the primer sequences. But now I understand, they are only the genomic sequences at that position.

GaretJax commented 6 years ago

Yes, it's the same thing; if you click on the curved arrow icon (the one in the middle) you get the same thing.

Our tool always shows the sequences in ordered position (from the lower coordinate to the higher coordinate)

GaretJax commented 6 years ago

what is the difference between the primer sequences and the genomic sequences? Shouldn't they be the same?

AnCaTjin commented 6 years ago

primer_orientierung_pfeil

AnCaTjin commented 6 years ago

I tried to find the primer sequence in the output (red arrows)

GaretJax commented 6 years ago

And it's there, right?

GaretJax commented 6 years ago

Just reversed because found on the - strand.

AnCaTjin commented 6 years ago

Everything is alright :) I just thought the overview would display the primer sequence (as entered). But of course the sequence (genomic) has to be turned.

GaretJax commented 6 years ago

Cool :-) if you have suggestions to make it clearer, I’m happy to do so!

AnCaTjin commented 6 years ago

primer_uebersicht