search

genome-nexus / genome-nexus-annotation-pipeline

Library and tool for annotating MAF files using Genome Nexus Webserver API
MIT License
8 stars 27 forks source link

Handle incorrect MAF format for deletions #174

Closed inodb closed 3 years ago

inodb commented 3 years ago

This MAF format is incorrect:

ADGRA2  8       37699139        37699138        GENIE-SAGE-1-1  DEL     CCGCCCCGGGCCCTGCCCGCCGCC        -

Since it should be:

GPR124  8       37699138        37699161        GENIE-SAGE-1-1  DEL     CCGCCCCGGGCCCTGCCCGCCGCC        -

We could fix the MAF format on our end (since we know the length of the deletion and could for instance assume the start_position is correct). This might be better done at the server layer than in the command line annotator

inodb commented 3 years ago

Turns out this is more complicated because sometimes the end_position is correct and sometimes start_position.