flexbar: Too many arguments!

[hrhotz]

Hi

I have just installed hyb together with the current version of flexbar (version: 3.4.0). When I run the test, I get the following error:

$ hyb analyse in=testdata.txt db=hOH7 hyb: Wed Aug 15 15:03:53 CEST 2018 analyse in=testdata.txt id=testdata format=fastq code= miss=0 qc=flexbar qual=33 link=TGGAATTCTCGGGTGCCAAGGC min=4 len=17 trim=0 filt=0 pc=0 align=bowtie2 db=hOH7 word=11 eval=0.1 ref= anti=0 type=all fold=UNAfold pref=mim hval=0.1 hmax=10 gmax=4 /***/flexbar -t testdata_clipped_qf -f sanger -r testdata.txt -as TGGAATTCTCGGGTGCCAAGGC -ao 4 -u 3 -m 17 -n 24 flexbar: Too many arguments!

Available on github.com/seqan/flexbar

make: *** [testdata_clipped_qf.fastq] Error 1 $

As it turns out, the culprit is "-f sanger". According to the flexbar help, the "-f" option does not accept a string (any more?):

Output selection: -f, --fasta-output Prefer non-quality format fasta for output.

Which version of flexbar do you recommend to use?

Thank you very much for your help Hans-Rudolf

[gkudla]

Hi Hans-Rudolf,

Thanks for reporting this!

hyb has been tested with flexbar versions 2.5 and 2.33. flexbar version 2.5 can be found here: https://github.com/seqan/flexbar/releases/tag/v2.5.0

Hope that helps! Greg

[tony-travis]

On 15/08/18 16:49, gkudla wrote:

Hi Hans-Rudolf,

Thanks for reporting this!

hyb has been tested with flexbar versions 2.5 and 2.33. flexbar version 2.5 can be found here: https://github.com/seqan/flexbar/releases/tag/v2.5.0

Hope that helps! Greg

Hi, Hans-Rudolf and Greg.

The earlier versions of "flexbar" took a format string:

-f, --format STR
      Quality format: sanger, solexa, i1.3, i1.5, i1.8 (illumina 1.8+).

Greg's suggestion of using "flexbar" 2.5 is the simplest work-around for now until we update "hyb" to make it use the new version of "flexbar".

Bye,

Tony.

-- Minke Informatics Limited, Registered in Scotland - Company No. SC419028 Registered Office: 3 Donview, Bridge of Alford, AB33 8QJ, Scotland (UK) tel. +44(0)19755 63548 http://minke-informatics.co.uk mob. +44(0)7985 078324 mailto:tony.travis@minke-informatics.co.uk

[hrhotz]

Dear Greg and Tony

Thank you very much for your quick help

Regards, Hans-Rudolf

[williamtmillsiv]

For those who might be curious, it is the -as parameter denoting the adapter sequence used in earlier versions of Flexbar but not in later versions that is causing the issue.