search

gregorykucherov / mreps

mreps: software for tandem repeat identification in DNA
http://mreps.univ-mlv.fr
GNU General Public License v2.0
13 stars 5 forks source link

-from and -to with multiple sequences in FASTA file? #8

Closed tseemann closed 4 years ago

tseemann commented 4 years ago

Does mreps support multifasta?

If so, how does it know which sequence ID to apply this to?

 -from n      : starting position n
 -to n        : end position n
gregorykucherov commented 4 years ago

Yes this combination is possible, in this case, mreps applies -from and -to to each file

tseemann commented 4 years ago

I don't understand what you mean.

If I have a file replicons.fasta:

>chr
ACGATATTAAATATATAGAG
>plasmid1
GCTATATATA
>plasmid2
ATGCTTAT

and i run mreps -from 1 -to 3 on replicons.fasta it will examine all of the sequences at the same coordinates? ie. examine ACG in chr, GCT in plasmid1 and ATG in plasmid2 ?

That isn't what I would want to happen.

I would want to say -seqid plasmid1 -from 3 -to 8 etc. Or use the de facto standard notations of seqid:start-end like in samtools etc

gregorykucherov commented 4 years ago

Torsten, yes it will examine all of the sequences at the same coordinates. Exactly as you say. Currently, if you want to analyse only some sequences in a multi-fasta file, you have to extract them first. Concerning -seqid, this feature can easily be added of course, I'll do this as soon as I have time (which may not be very soon, unfortunately).

tseemann commented 4 years ago

Thanks for replying. I'll find another tool for the time being.