missing directories

[ceheitsch]

@maxieds Although gtfold will build on my office machine it does not run:

math11024:bin heitsch$ ./gtmfe test.txt 
GTfold: A Scalable Multicore Code for RNA Secondary Structure Prediction
(c) 2007-2011  D.A. Bader, C.E. Heitsch, S.C. Harvey
Georgia Institute of Technology

Checking for environ variable 'GTFOLDDATADIR', not found 
Checking for default datadir 'DATADIR', not found.
Checking under current dir '/Users/heitsch/gtgithub/gtfold/bin/data', not found.

[maxieds]

@ceheitsch This is not really something that I think should be addressed directly by the build process. If you recall, we had some similar issues with paths in PMFE (you are now running the binary outside of the source folder as of the most recent cmake build procedure).

What it is looking for (complaining about), is that it doesn't know where to find the thermodynamic parameter data. One possible way to fix this (not versatile), would be:

• Hard code A set of thermodynamic parameter data directly into the C code (vis a vis, the StructViz solution to images and icons, by embedding the raw pixel data into static header files);
• Or, two we could do a variant of the new build script for the PMFE project that learns where to look at compile time.

The way I get around this is to re-use a setting that gets installed into the user's bash profile when configuring our GTFoldPython bindings. In other words, export the variable GTFOLDDATADIR in the shell startup config, so that it points to somewhere sensible no matter where you run the gtfold binary. Here is an example:

(~/.bash_profile -- On MacOS)

$ echo -e "export GTFOLDDATADIR=\"$(greadlink -f "/path/to/my/home/GTFoldTurner99")\"\n" >> ~/.bash_profile
$ source ~/.bash_profile

Then try re-running. That should fix the issue for now. 😄

[ceheitsch]

@maxieds To clarify, I'm trying to run gtmfe from /Users/heitsch/gtgithub/gtfold/bin; see below. In other words, while the comparison with pmfe may apply in other situations, it shouldn't here. Also, I've just confirmed that the thermodynamic data is available in /Users/heitsch/gtgithub/gtfold/bin/data, only the program doesn't seem to be finding it.

math11024:bin heitsch$ pwd
/Users/heitsch/gtgithub/gtfold/bin
math11024:bin heitsch$ ./gtmfe test.txt 
GTfold: A Scalable Multicore Code for RNA Secondary Structure Prediction
(c) 2007-2011  D.A. Bader, C.E. Heitsch, S.C. Harvey
Georgia Institute of Technology

Checking for environ variable 'GTFOLDDATADIR', not found 
Checking for default datadir 'DATADIR', not found.
Checking under current dir '/Users/heitsch/gtgithub/gtfold/bin/data', not found.

One possibility worth considering is that because you have customized your bash_profile (as described and I'm sure in other ways) then this is masking problems with the code.

[maxieds]

@ceheitsch This should be fixed given what I added to the build configuration today:

$ ./bin/gtmfe -m ../GTFoldPython/Python/Testing/TestData/tRNA/yeast.fa.seq 
GTfold: A Scalable Multicore Code for RNA Secondary Structure Prediction
(c) 2007-2011  D.A. Bader, C.E. Heitsch, S.C. Harvey
Georgia Institute of Technology

Run Configuration:
+ enabled terminal mismatch calculations
- thermodynamic parameters: /Users/mschmidt34/GTDMMBSoftware/gtfold/gtfold-mfe/data/Turner99/
- input file: ../GTFoldPython/Python/Testing/TestData/tRNA/yeast.fa.seq
- sequence length: 75
- output file: yeast.fa.ct

Computing minimum free energy structure...
Done.

Results:
- Minimum Free Energy:     -29.3000 kcal/mol
- MFE runtime:  0.003639 seconds

GCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGCGCCA
((((((((........((((....(((((((.....)))).)))))))((((......)))).))))))))....

MFE structure saved in .ct format to yeast.fa.ct

[maxieds]

@ceheitsch Can we close out this issue?