hadasvolk
commented
6 months ago You should specify the full name of the fastq files, if you haven't gzipped them
trimmomatic PE SRR1569760_sub_1.fastq.gz SRR1569760_sub_2.fastq.gz -baseout SRR1569760 ILLUMINACLIP:NexteraPE-PE.fa:2:30:10
I have an issue runing trimmomatic. It seems like I am missing a file to actually run the command. It says that it does not find one of teh files, however, if i list everything in my home directory, this file appears.
I tried deleting ALL files in the environment and rerunning everything, the same issue appears. Anyone can help?
The commandline i am running: trimmomatic PE SRR1569760_sub_1.fastqc SRR1569760_sub_2.fastqc -baseout SRR1569760 ILLUMINACLIP:NexteraPE-PE.fa:2:30:10
This is the output: TrimmomaticPE: Started with arguments: SRR1569760_sub_1.fastqc SRR1569760_sub_2.fastqc -baseout SRR1569760 ILLUMINACLIP:NexteraPE-PE.fa:2:30:10 Multiple cores found: Using 4 threads Using templated Output files: SRR1569760_1P SRR1569760_1U SRR1569760_2P SRR1569760_2U Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG' Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG' Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG' Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC' Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA' ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences Exception in thread "main" java.io.FileNotFoundException: SRR1569760_sub_1.fastqc (No such file or directory) at java.io.FileInputStream.open0(Native Method) at java.io.FileInputStream.open(FileInputStream.java:195) at java.io.FileInputStream.(FileInputStream.java:138)
at org.usadellab.trimmomatic.fastq.FastqParser.parse(FastqParser.java:135)
at org.usadellab.trimmomatic.TrimmomaticPE.process(TrimmomaticPE.java:265)
at org.usadellab.trimmomatic.TrimmomaticPE.run(TrimmomaticPE.java:555)
at org.usadellab.trimmomatic.Trimmomatic.main(Trimmomatic.java:80)