Dear,
Thanks for the tutorial and data you prepared.
It works very well in step 1, however, I stuck in Step 2 with the dataset from step1.
All files and folders from step 1 are good.
But I got zero bytes of file "L001_R1parsed.merged.fq.gz" and only 20 bytes of file "L001_SE_R1parsed.fq.gz"
The version of trimmomatic I applied is 0.39. All scripts are ran under Mac system.
Following is the script I used:
perl /Users/shu-yunchen/Desktop/GBS/SNP_detection/GBS_SNP_CROP_master_test_20190902/GBS-SNP-CROP-scripts/v.4.0/GBS-SNP-CROP-2.pl -tm /Users/shu-yunchen/Desktop/GBS/SNP_detection/GBS_SNP_CROP_master_test_20190902/Tutorial_Data/trimmomatic-0.39.jar -d SE -fq L001 -t 10 -ph 33 -ad /Users/shu-yunchen/Desktop/GBS/SNP_detection/GBS_SNP_CROP_master_test_20190902/Tutorial_Data/TruSeq3-SE.fa:2:30:10 -l 30 -sl 4:30 -tr 30 -m 32
Concatenating library L001 reads ... cat: L001*R1parsed.fq.gz: No such file or directory
DONE.
Trimmomatic single-end reads cleanning/trimming initiated...
TrimmomaticSE: Started with arguments:
-phred33 -threads 10 L001_R1parsed.merged.fq.gz L001_SE_R1parsed.fq.gz MINLEN:32 ILLUMINACLIP:/Users/shu-yunchen/Desktop/GBS/SNP_detection/GBS_SNP_CROP_master_test_20190902/Tutorial_Data/TruSeq3-SE.fa:2:30:10 LEADING:30 SLIDINGWINDOW:4:30 TRAILING:30 MINLEN:32
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 0 Surviving: 0 (�%) Dropped: 0 (�%)
TrimmomaticSE: Completed successfully
There are not reads be input into the analysis, to confirm the ability of Trimmomatic, I tried to use Trimmomatic directly and it worked well with 500000 reads as input.
Would you please give me some suggestion to solve the problem?
Dear, Thanks for the tutorial and data you prepared. It works very well in step 1, however, I stuck in Step 2 with the dataset from step1. All files and folders from step 1 are good. But I got zero bytes of file "L001_R1parsed.merged.fq.gz" and only 20 bytes of file "L001_SE_R1parsed.fq.gz" The version of trimmomatic I applied is 0.39. All scripts are ran under Mac system.
Following is the script I used: perl /Users/shu-yunchen/Desktop/GBS/SNP_detection/GBS_SNP_CROP_master_test_20190902/GBS-SNP-CROP-scripts/v.4.0/GBS-SNP-CROP-2.pl -tm /Users/shu-yunchen/Desktop/GBS/SNP_detection/GBS_SNP_CROP_master_test_20190902/Tutorial_Data/trimmomatic-0.39.jar -d SE -fq L001 -t 10 -ph 33 -ad /Users/shu-yunchen/Desktop/GBS/SNP_detection/GBS_SNP_CROP_master_test_20190902/Tutorial_Data/TruSeq3-SE.fa:2:30:10 -l 30 -sl 4:30 -tr 30 -m 32
And the result I got as followed:
#################################
GBS-SNP-CROP, Step 2, v.4.0
################################# Trimming Single-End reads ...
Concatenating library L001 reads ... cat: L001*R1parsed.fq.gz: No such file or directory DONE. Trimmomatic single-end reads cleanning/trimming initiated...
TrimmomaticSE: Started with arguments: -phred33 -threads 10 L001_R1parsed.merged.fq.gz L001_SE_R1parsed.fq.gz MINLEN:32 ILLUMINACLIP:/Users/shu-yunchen/Desktop/GBS/SNP_detection/GBS_SNP_CROP_master_test_20190902/Tutorial_Data/TruSeq3-SE.fa:2:30:10 LEADING:30 SLIDINGWINDOW:4:30 TRAILING:30 MINLEN:32 Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA' Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' ILLUMINACLIP: Using 0 prefix pairs, 2 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences Input Reads: 0 Surviving: 0 (�%) Dropped: 0 (�%) TrimmomaticSE: Completed successfully
There are not reads be input into the analysis, to confirm the ability of Trimmomatic, I tried to use Trimmomatic directly and it worked well with 500000 reads as input. Would you please give me some suggestion to solve the problem?
Best, Shu-Yun