search

hartleys / QoRTs

Quality of RNA-Seq Toolset
52 stars 14 forks source link

Question: Caught exception in calcReferenceMatch on read #90

Open Rhinogradentia opened 1 year ago

Rhinogradentia commented 1 year ago

Hi,

I get following error message when running qorts on aligned RNASeq data:

Caught exception in calcReferenceMatch on read 1184132
   offending read1:
A00700:990:HJT2CDSX7:2:2211:30174:18176 83      scaffold_23     6364    255     60M14S  =       6364    -60     CATAACCTCATCACAGCAAAACACATTTTCCTCAAGATCCAGCGGAATTTTATCCTGGGGTGGCATTGCGCAAT      FFFFFFFFFFFFFF:FFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF      MC:Z:60M14S     MD:Z:56C3       NH:i:1  HI:i:1  jI:B:i,-1       NM:i:1  jM:B:c,-1       nM:i:2  AS:i:115
   offending read2:
A00700:990:HJT2CDSX7:2:2211:30174:18176 163     scaffold_23     6364    255     60M14S  =       6364    60      CATAACCTCATCACAGCAAAACACATTTTCCTCAAGATCCAGCGGAATTTTATCCTGGGGTGGCATTGCGCAAT      FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFF      MC:Z:60M14S     MD:Z:56C3       NH:i:1  HI:i:1  jI:B:i,-1       NM:i:1  jM:B:c,-1       nM:i:2  AS:i:115

Fatal error thrown for read: A00700:990:HJT2CDSX7:2:2211:30174:18176
============================FATAL_ERROR============================
QoRTs encountered a FATAL ERROR. For general help, use command:
          java -jar path/to/jar/QoRTs.jar --man
============================FATAL_ERROR============================
Error info:

I can't figure out what is wrong with this read. The only thing what comes to mind is that the annotation in the provided gff on this scaffold starts at position 8000-something. Is there a way to get more information on what bothers qorts regarding this error? Could it be the positions (both the same)?

Thank you a lot in advance. Best, Nadine