search

heathsc / bs_call

DNA methylation and variant Caller for Bisulfite Sequencing Data.
GNU General Public License v3.0
5 stars 3 forks source link

Parsing SAM error #2

Open paulstretenowich opened 5 years ago

paulstretenowich commented 5 years ago

Hi Simon, I am running bs_call after a gem3 mapping and I am facing a Parsing SAM error but I don't understand why when I look into my bam file. The line pointed by the error seems like another bam line. Here is the cmd used: samtools view -h file.bam | bs_call -r genome.fa -n name | bcftools convert -o name.bcf -O b And the error: Error (gt_input_sam_parser.c:319,gt_input_sam_parser_prompt_error) Parsing SAM error(<\<STREAM>>:1237315:359). Expected number The corresponding line in the bam is: E00432:139:HMCJ3CCXY:3:2102:2361:9800 165 chr19 58607454 0 * = 58607454 0 TGGGAAAATTTAAGTAGGTGGGATGGAATAGTTAGAATGTATTTATAAAAAATAAATTGAAAATATTTGGAGAATAGTATTAATGATTATTATGAATGTTAATTTATATTTTTAATAATTTAGTGTTGTTATTTTTTAAATTTTTTATGTT AAFFFFJFJJJJJJJJAJFJJJJ<A<FFFJJJJ-JAAJJJJJJJ<JJJJJJJJJJJJJJJJJAJJJJJJFJJFAJ<AJFJJJJJJJJJJJJFJJJFAJJJ-AJJJJJJJJFFJJJFJJFAF-AJJJJJAFJFFJJAF-7-7-7<-A-F<<A

Thanks for the help, Paul

heathsc commented 5 years ago

Hi Paul,

Sorry for the delay getting back to you on this. The line from the BAM that you show looks as if it has been truncated as it has no tags after the quality field. Could you extract this line with a few lines before and after it in the BAM file and send them to me?

Cheers, Simon

On 9 May 2019, at 23:20, Paul STRETENOWICH notifications@github.com wrote:

Hi Simon, I am running bs_call after a gem3 mapping and I am facing a Parsing SAM error but I don't understand why when I look into my bam file. The line pointed by the error seems like another bam line. Here is the cmd used: samtools view -h file.bam | bs_call -r genome.fa -n name | bcftools convert -o name.bcf -O b And the error: Error (gt_input_sam_parser.c:319,gt_input_sam_parser_prompt_error) Parsing SAM error(<>:1237315:359). Expected number The corresponding line in the bam is: E00432:139:HMCJ3CCXY:3:2102:2361:9800 165 chr19 58607454 0 * = 58607454 0 TGGGAAAATTTAAGTAGGTGGGATGGAATAGTTAGAATGTATTTATAAAAAATAAATTGAAAATATTTGGAGAATAGTATTAATGATTATTATGAATGTTAATTTATATTTTTAATAATTTAGTGTTGTTATTTTTTAAATTTTTTATGTT AAFFFFJFJJJJJJJJAJFJJJJ<A<FFFJJJJ-JAAJJJJJJJ<JJJJJJJJJJJJJJJJJAJJJJJJFJJFAJ<AJFJJJJJJJJJJJJFJJJFAJJJ-AJJJJJJJJFFJJJFJJFAF-AJJJJJAFJFFJJAF-7-7-7<-A-F<<A

Thanks for the help, Paul

— You are receiving this because you are subscribed to this thread. Reply to this email directly, view it on GitHub https://github.com/heathsc/bs_call/issues/2, or mute the thread https://github.com/notifications/unsubscribe-auth/AAY46576RFMSJHPFCS25V63PUSIR5ANCNFSM4HL6DI7A.

paulstretenowich commented 5 years ago

Hi Simon,

Thanks for the reply. Here is an extract of 10 lines around the error line of the bam file.

Paul

GM12878_chr19.methylseq.pe.sorted.extract.bam.txt