search

hyeshik / poreplex

A versatile sequenced read processor for nanopore direct RNA sequencing
Other
78 stars 13 forks source link

Barcodes #5

Closed teshomeb closed 5 years ago

teshomeb commented 5 years ago

Is it possible to add more barcodes other than the four DNA barcodes listed. For example, oxford nanopre RTA

BC5_OligoA /5Phos/GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC BC5_OligoB GAGGCGAGCGGTCAATTTTCCTAAGAGCAAGAAGAAGCCTTTTTTTTTT

hyeshik commented 5 years ago

To add a support for more adapters, we need raw signal files (at least 100k reads per barcode) generated using all of the barcodes to be supported.

The current model in the official package was trained with a pooled sample of four DRS libraries as follows:

I think, to scale up for more barcodes, using two or three different in vitro transcribed & polyadenylated RNAs for each barcode would work, too.