No such file [...]/references/hg38/gdc/GRCh38.d1.vd1/fasta/hg38.len

[richelbilderbeek]

Dear nextNEOpi maintainers,

I try to get nextNEOpi running for a minimal run, without experience in the field. I could not find example data (#33) or any testing scripts, so all I am left to do is post an Issue :-)

In this GitHub repository I try to setup a most simple example, (including a GitHub Actions script):

• example_batchfile.csv, which I adapted from the example file provided. Here is its full content:

sampleName,reads1,reads2,sampleType,HLAfile,sex
sample1,reads_s1_t_1.fastq.gz,reads_s1_t_2.fastq.gz,tumor_DNA,,female
sample1,reads_s1_n_1.fastq.gz,reads_s1_n_2.fastq.gz,normal_DNA,,female
sample1,reads_s1_r_1.fastq.gz,reads_s1_r_2.fastq.gz,tumor_RNA,,female

• reads_s1_n_1.fastq.gz: an example FASTQ file that I took from Wikipedia:

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
\!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

• reads_s1_n_2.fastq.gz: same as reads_s1_n_1.fastq.gz
• reads_s1_r_1.fastq.gz: same as reads_s1_n_1.fastq.gz
• reads_s1_r_2.fastq.gz: same as reads_s1_n_1.fastq.gz
• reads_s1_t_1.fastq.gz: same as reads_s1_n_1.fastq.gz
• reads_s1_t_2.fastq.gz: same as reads_s1_n_1.fastq.gz

Using GitHub Actions I get this error:

No such file: /home/runner/work/nextNEOpi_example_1/nextNEOpi_example_1/nextNEOpi/resources/references/hg38/gdc/GRCh38.d1.vd1/fasta/hg38.len

I understand that the name of this file is determined in conf/resources.config.

But where do I get that data?

I do understand it is a human reference genome, however, [path]/hg38/gdc/GRCh38.d1.vd1/fasta/hg38.len confuses me.

Is there a URL where I can wget it all?

Thanks and cheers, Richel Bilderbeek

[riederd]

Hi,

please see the README where we line out the usage, i.e.: https://github.com/icbi-lab/nextNEOpi#12-references

HTH

[richelbilderbeek]

Silly me :man_facepalming: ! Thanks @riederd!