Closed ssnn-airr closed 9 years ago
Original comment by Jason Vander Heiden (Bitbucket: javh, GitHub: javh).
Slowly getting through the issues...
I will confess this is partly motivated by the fact that I couldn't get deletions in the input sequence to translate to the ERROR rate in MaskPrimers exactly how I wanted them too... Example:
SEQ> CGGATCTTCTACTCAAAACCGTCC-TCAGTCGTGGATCTGGTCTAGCTGGG
PR> ---------------AATACGTCCGTCAGTCGTGGATGT------------
ALN> ** - *
ERROR> 0.208333
ERROR is 5/24 (20 character matches, -1 gap penalty), when it should probably be 4/24, but fixing this leads to some nasty side effects that break otherwise correct alignments. Just FYI.
If you want to see what effect changing the gap penalty has on the alignments, you can just change the gap_penalty=(1, 1)
argument line 132 in tests/tests_MaskPrimers.py and look at the test case output.
Original comment by Anonymous.
cool!
Original report by Anonymous.
I believe a gap open should be penalized more than an substitution. Though depending on the technology and the length of the primer i can see arguments against this.
An ungapped alignment option could support the extreme case of this.
Unexpected gapping becomes an issue when amplicon structure is defined and processed according to the expected lengths of various components.
We can get around this in a number of ways, but i wanted to put the idea out there.