seq_file.c:255: Warning -- plain file starts with non-ACGTN

[FelipeMelis]

I get this error when i execute mykrobe.predictor.tb or mykrobe.predictor.staph, i am using fastq files.

seq_file.c:255: Warning -- plain file starts with non-ACGTN base
seq_file.c:264: Error -- ungetc failed

[Phelimb]

Can you copy the full command you've used? Did you use --list or --file?

If possible could you also show the output of

head fasta.fq

?

[FelipeMelis]

The command i use:

$ ./mykrobe.predictor.staph --file demo_input_file_for_S.aureus_app.fastq --install_dir ../

The head of the fastq file is:

@GAII04_0003:1:1:1006:19391#GCCAAT
NTGTAAGCTTTGTTTGTTAATTGCTCTTGTAGTTCATAGTTAATATACACA
+
#//+.99;99A@=>42>;>?<==>=@?@@<67;;;:::::<<;<=@??A@#
@GAII04_0003:1:1:1008:19779#GCCAAT
NAGAAGAGAAGAAGTAGATGCATTTTTAGATGACATTATTGCTGATTATCA
+
#**('+%+(+:978<>=<<=@@?@?22'89<<>>8A??A=7::=:::<:6<
@GAII04_0003:1:1:1011:1443#GCCAAT
NTCGCTATTCTGACGATAATTTTAACGATAATTGCTTTGATTTTTTTGCCA

[Phelimb]

I can't seem to replicate. What operating system are you using ?

[FelipeMelis]

I am using MacOSX the yosemite version.

[iqbal-lab]

seq_ungetc depends on existence of gzungetc. Is is possible zlib is not installed or something?

[Phelimb]

xcode-select --install

should install zlib on a mac if it's not already. Could you try that @FelipeMelis and see if it helps?

[FelipeMelis]

I have already install xcode on my mac (even update the xcode and doesn`t work). I tried everything and i get the same problem.

[FelipeMelis]

Finally i used a linux environment and works fine. Thanks for all your helps.