Closed FelipeMelis closed 5 years ago
Can you copy the full command you've used? Did you use --list or --file?
If possible could you also show the output of
head fasta.fq
?
The command i use:
$ ./mykrobe.predictor.staph --file demo_input_file_for_S.aureus_app.fastq --install_dir ../
The head of the fastq file is:
@GAII04_0003:1:1:1006:19391#GCCAAT
NTGTAAGCTTTGTTTGTTAATTGCTCTTGTAGTTCATAGTTAATATACACA
+
#//+.99;99A@=>42>;>?<==>=@?@@<67;;;:::::<<;<=@??A@#
@GAII04_0003:1:1:1008:19779#GCCAAT
NAGAAGAGAAGAAGTAGATGCATTTTTAGATGACATTATTGCTGATTATCA
+
#**('+%+(+:978<>=<<=@@?@?22'89<<>>8A??A=7::=:::<:6<
@GAII04_0003:1:1:1011:1443#GCCAAT
NTCGCTATTCTGACGATAATTTTAACGATAATTGCTTTGATTTTTTTGCCA
I can't seem to replicate. What operating system are you using ?
I am using MacOSX the yosemite version.
seq_ungetc depends on existence of gzungetc. Is is possible zlib is not installed or something?
xcode-select --install
should install zlib on a mac if it's not already. Could you try that @FelipeMelis and see if it helps?
I have already install xcode on my mac (even update the xcode and doesn`t work). I tried everything and i get the same problem.
Finally i used a linux environment and works fine. Thanks for all your helps.
I get this error when i execute
mykrobe.predictor.tb
ormykrobe.predictor.staph
, i am using fastq files.