Closed mictadlo closed 6 years ago
Hi,
I am encountering the same problem as described above. I have been running "graphmap" with the following command "graphmap align -t 8 -r ref.fasta -d reads.fasta -o gm_results.sam". However, for some reads from "ref.fasta" I get "Segmentation fault": [20:59:03 ProcessReads] [CPU time: 1028.20 sec, RSS: 1425 MB] Read: 72876/81352 (89.58%) [m: 60681, u: 12188], length = 1586, qname: SSscaffold-832 1586 /var/spool/slurmd/job7479643/slurm_script: line 15: 137866 Segmentation fault graphmap align -t 8 -r ref.fasta -d reads.fasta -o gm_results.sam
I am using 150gb of RAM, and the consumption of this job is ~2GB, so I don't think it is a memory issue. One of the reads for which this happens is:
SSscaffold-832 1586 CCGGCGCCCTGGTCGGCGGCCGTCCCGGCCACGGCCCGGACGGCGAGCTGACCGTGGCCGCCGCCCCGGGCGTGTACGAG When I remove these reads, and run "graphmap" again, the alignment finishes ok.
I would appreciate if you have any suggestions why this occurs, and how can I can avoid it.
Thank you, Natasha
@isovic , thank you so much for fixing this issue. I tried the new release, and the "Segmentation fault" error is now resolved.
Hi Natasha, Thank you for reporting that the issue is resolved!
Michal, did the update solve the segfault you were experiencing?
Best regards, Ivan.
I did not have time to try it again but @nnnagara said it works for him with the new release.
Hi, I got Segmentation fault during alignment step:
What did I miss?
Thank you in advance.
Michal