Closed dcm9123 closed 4 years ago
Hi Daniel,
could you please run head -n 1
for each of the following files: barcode02.fastq
, aln_2.sam
and msp2_pf3d7_02026800.fasta
?
Sorry for the wait.
Best regards, Robert
No problem, here's the output:
head -n 1 barcode02.fastq
@3a699ef0-8ee5-48a1-b2b3-4ff4d0e76d25 runid=7c6c69b0c1ae60abfe91b0d0c44ea2031ed4d1a4 read=6 ch=342 start_time=2019-08-01T00:25:12Z flow_cell_id=FAL13168 protocol_group_id=cpmp_and_msp2 sample_id=cpmp_and_msp2
head -n 1 aln_2.sam
@SQ SN:plasmodb_pf3d7_msp2_0206800 LN:819
head -n 1 msp2_pf3d7_02026800.fasta
plasmodb_pf3d7_msp2_0206800
Can you do the same for aln_2.paf
?
Sure, no problem:
3a699ef0-8ee5-48a1-b2b3-4ff4d0e76d25 701 18 691 - plasmodb_pf3d7_msp2_0206800 819 39 655 255 696 60 tp:A:P cm:i:32 s1:i:237 s2:i:0 dv:f:0.0864 rl:i:0
That looks alright. Would you mind sharing the files so I can check what is wrong locally?
Not at all! Just sent it to robert.vaser@fer.hr
Thanks!!!
Hi Daniel,
this issue should be fixed in latest commit (v1.4.8
at https://github.com/lbcb-sci/racon). Thanks for finding this bug!:)
Sorry for the wait. Best regards, Robert
It is working now! Thanks a lot for the help! Looking at the latest commit, I assume that the bug was fixed for short amplicons (which is my case)? With the latest commit, should I be getting corrected fastq files by using the following command?
racon -u -f -w 50 -q 9 ../trim50_dem_q9/barcode02.fastq ../minimap2_output_x_map_ont/aln_2.sam ../gene_references/msp2_pf3d7_02026800.fasta
I am asking because I ran it like that, and I am getting what I believe it's a consensus fasta sequence, even though I added the -f
flag, am I running something wrong to get my .fastq corrected fragments?
If you want to correct each sequence in your barcode02.fastq
file, you have to map those sequences to each other. Follow the commands bellow:
minimap2 -ax ava-ont --dual=yes barcode02.fastq barcode02.fastq > ava_2.sam
racon -u -f -w 50 -q 9 barcode02.fastq ava_2.sam barcode02.fastq > barcode02_polished.fasta
Ok, thanks a lot! The minimap2 command took a while, but I guess that's because of my number of sequences that were mapped to each other. However, the racon command is throwing me the following error after running the suggested command:
[racon::Polisher::initialize] loaded target sequences 0.106122 s
[racon::Polisher::initialize] loaded sequences 0.065136 s
terminate called after throwing an instance of 'std::invalid_argument'
what(): [bioparser::SamParser] error: invalid file format!
Aborted (core dumped)
do you know what is happening here?
Hmmm, did you copy the above minimap2 command? Can you run head -n 10 ava_2.sam
and tail -n 10 ava_2.sam
?
I did, plus I added a the -t
to add my threads. The output looks like this:
head -n 10 ava2.sam:
-bash-4.2$ head -n 10 ava2.sam
@SQ SN:3a699ef0-8ee5-48a1-b2b3-4ff4d0e76d25 LN:701
@SQ SN:cffdbb37-253b-4cf6-9bf0-e9ef9925ce2a LN:95
@SQ SN:75512032-9812-4dd5-93d9-45d8fdb75705 LN:617
@SQ SN:4dbb5fef-bc18-467f-9ceb-63b03c1eee55 LN:176
@SQ SN:aa3c542a-04fb-4926-809e-87ea2b098525 LN:687
@SQ SN:be529844-6bd7-4427-b81a-e19435691f39 LN:726
@SQ SN:8a37475c-8ff9-42e9-bc65-960fa37c5d2a LN:653
@SQ SN:76a4299e-6c61-4c71-8a95-8c108f18d4f5 LN:113
@SQ SN:74ed9b39-6f68-4bac-91e3-7e8f6f4f9a7a LN:705
@SQ SN:b31c93fd-5157-4e17-950c-9094f3c93396 LN:76
the tail:
-bash-4.2$ tail -n 10 ava2.sam
509cc2b7-4571-42c0-b248-33d1204f716b 256 75ca8e50-423f-4374-a142-1751fa5269bb 190 0 51M64D22M1I16M1D52M1D15M1I2M1D37M1I18M1D19M * NM:i:75 ms:i:296 AS:i:310 nn:i:0 tp:A:S cm:i:20 s1:i:125 de:f:0.0500 rl:i:192
509cc2b7-4571-42c0-b248-33d1204f716b 256 e7466576-2851-44e6-b2f8-9a05e027c008 71 0 50M22D60M1D32M1D10M1I4M1I2M1D18M2D18M2I18M19S * NM:i:39 ms:i:282 AS:i:284 nn:i:0 tp:A:S cm:i:15 s1:i:103 de:f:0.0727 rl:i:192
509cc2b7-4571-42c0-b248-33d1204f716b 256 cdde8217-e1f8-41f1-bcf2-806c2e05fb94 76 0 7M1I15M2D14M2I10M2D25M26D16M1D8M2I37M1D5M1D10M1I4M1I2M1D37M2I36M * 0 0 * * NM:i:49 ms:i:278 AS:i:284 nn:i:0 tp:A:S cm:i:19 s1:i:110 de:f:0.0795 rl:i:192
509cc2b7-4571-42c0-b248-33d1204f716b 256 fdb0052a-6074-4a79-8c45-64e75827bdc8 627 0 51M9D2M12D37M1D4M2D43M1D5M1D10M1I4M1I2M1D9M3I26M2I11M24NM:i:38 ms:i:272 AS:i:272 nn:i:0 tp:A:S cm:i:23 s1:i:111 de:f:0.0698 rl:i:192
509cc2b7-4571-42c0-b248-33d1204f716b 256 a208aa86-2310-4048-a2e1-91d73ddb2a12 30 0 48M1D5M1D37M1D4M40D48M1D15M1I2M1D33M42S * 0 NM:i:49 ms:i:246 AS:i:266 nn:i:0 tp:A:S cm:i:22 s1:i:116 de:f:0.0503 rl:i:192
509cc2b7-4571-42c0-b248-33d1204f716b 256 de820508-015c-4fc3-855c-ae654470967f 86 0 49M1D6M1D15M40D20M1D52M1D15M3I8M2D9M1I19M1I18M19S NM:i:58 ms:i:242 AS:i:262 nn:i:0 tp:A:S cm:i:12 s1:i:106 de:f:0.0727 rl:i:192
509cc2b7-4571-42c0-b248-33d1204f716b 256 b610e46a-9a3a-4757-8429-a06703be069e 43 0 74M1D16M2D29M41I34M3D8M1D14M3D19M * 0 NM:i:58 ms:i:220 AS:i:241 nn:i:0 tp:A:S cm:i:14 s1:i:109 de:f:0.0650 rl:i:192
509cc2b7-4571-42c0-b248-33d1204f716b 256 47aaa6dd-5475-4d0c-ae06-8be13669f916 229 0 12S8M1D3M1D5M2D21M1D21M26D20M29D47M1D5M1D16M1I18M1I18M1D4M1D16M1D9M1I9M * 0 0 * * NM:i:79 ms:i:182 AS:i:197 nn:i:0 tp:A:S cm:i:19 s1:i:103 de:f:0.1068 rl:i:192
a9d6ea3d-8eeb-4443-9872-a6e894370502 4 * 0 0 * GTTATTAAATTGCTGGTGCTGTCGATTCCGTTTGTAGTCGTCTGTTTAACCTACTTGCCTGTCGCTCCTATCTTCCTTTGTACCATCAGGTACATTCT '%&"#%%'0%&'+.48:?BGC@IBAGC:<BEF=-+5485/6<85@BBB>==2.,-*'+)1/.0&&*&79>@CFA,1,-,$D?DE0+8$%)5.@HBECA rl:i:0
ac83e59b-db95-4fee-a2d9-96bdb72b16b4 4 * 0 0 * TCAACTTGTATAATAGACAATGTTTTAATTACCTTCATGCAATATCAGCACCAACAGAAGGATTATGAACACGACTACTA;75-.00$77;?2,,$15LB;<?>4-/('+11310130=BI=3+(=699<JMT>><287%1$'%(((('$%',3474),=rl:i:0
The sam file looks fine, but could you send it via email so I can see what is wrong?
Sent! Thank you!
Found the error, will update the parser soon.
Bug fix is in the latest commit (v1.4.9
) :)
It works perfectly now! Thanks a lot!
Hi! I am currently trying to run the following command:
racon -u -f -w 50 -q 9 ../trim50_dem_q9/barcode02.fastq ../minimap2_output_x_map_ont/aln_2.sam ../gene_references/msp2_pf3d7_02026800.fasta
but I get the error: layer begin and positions are invalid
I am basically trying to get a set of fastq or fasta corrected sequences so I can tell the difference between sequencing errors from SNPs. My project consists of analysis of haplotypes, where SNP calling is crucial for this. The genes I sequenced using nanopore are short, around 550 bp and 800 bp (two different genes). I was looking at #118 and it seems that my error is a little bit different. I tried running it with both .sam and .paf and I am getting similar errors (ran an alignment using minimap2 previous to this, hence the .sam file I used).
However it works fine when I run this one:
racon ../trim50_dem_q9/barcode01.fastq ../minimap2_output_x_map_ont/aln_01.paf ../gene_references/msp2_pf3d7_02026800.fasta > test
, where I get a consensus fasta sequence, but I am looking forward to get a fasta set of corrected sequences.Thanks for your help,
Daniel