search

jaswindersingh2 / SPOT-RNA

RNA Secondary Structure Prediction using an Ensemble of Two-dimensional Deep Neural Networks and Transfer Learning.
https://apisz.sparks-lab.org:8443/spot-rna-sz.html
Mozilla Public License 2.0
95 stars 33 forks source link

About the output file #14

Closed Codezy99 closed 3 years ago

Codezy99 commented 3 years ago

Hi Jaswinder,

Great work! I have a question regarding the output of the tools. I was wondering how we can interpret the .prob files. Do all the numbers in this file mean the probability of a certain position to be paired? Thank you.

Best regards, You

jaswindersingh2 commented 3 years ago

Hi Zhou

.prob file is a LxL matrix which consists of base-pair probability of each nucleotide in a sequence with every other nucleotide in the sequence, where L is the length of the sequence.

If you are familier with python, you can simply read this .prob file in python using following command:

>>> y_pred = numpy.loadtxt(y_pred.prob)

If you plot 'y_pred', it will looks as follows:

y_pred

The above plot is for the following sequence:

>reference SPOT-RNA output GGGUGAUUAGCUCAGGGGAGAGCACCUCCCUACAAGGAGGGGGUCGGCGGUUCGAUCCCGUCAUCACCCACCA (((((((<.((((><....))))(((((((....)))))))...>((((((...)..))))))))))))....

Thanks

Codezy99 commented 3 years ago

Thanks for your clear answer. Have a great day : )