search

jfjlaros / demultiplex

Versatile FASTA/FASTQ demultiplexer.
MIT License
32 stars 5 forks source link

Is it possible for the barcode to contain non-ATCG characters? #27

Closed vivian9909 closed 2 years ago

vivian9909 commented 2 years ago

Hi jfjlaros,

I want to use the demultiplex demux command to separate my fastq files that contains non-ATCG character barcode in my header.

My header looks like this:

@M01065:238:000000000-KJ23L:1:1101:23857:16859:AACCTCTCCGGAACCTACGCCTCATCT_1
@M01065:238:000000000-KJ23L:1:1106:20412:2690:AACCTCTCCGGAACCTACGCCTCATCT_2

and my barcode file looks like this:

index1 AACCTCTCCGGAACCTACGCCTCATCT_1
index2 AACCTCTCCGGAACCTACGCCTCATCT_2

Is there a way for me to use your code to demultiplex this? Thank you so much!

vivian9909 commented 2 years ago

I have tried and it worded. Thanks. Sorry for the trouble.