Closed GoogleCodeExporter closed 9 years ago
Are you sure that this is the correct adapter sequence? I have a list of
Illumina adapters, which I found somewhere in the seqanswers forum. In it, the
adapter you give (CAA...TCT) is called “Illumina Single End Adapter 2”. But
there is also another adapter called “Illumina Small RNA 3p Adapter 1” with
the sequence ATCTCGTATGCCGTCTTCTGCTTG. That one fits much better:
@SRR768350.12 FCD0F4MABXX:8:1101:2337:2120 length=49
TGGAGTGTGACAATGGTGTTTGTATCTCGTATGCCGTCTTCTGCTTGAA
ATCTCGTATGCCGTCTTCTGCTTG
At least in humans, TGGAGTGTGACAATGGTGTTTG is an actual miRNA (hsa-miR-122-5p),
so that seems to be more correct.
Perhaps the actual adapter sequence you need to use is
TATCTCGTATGCCGTCTTCTGCTTG, that is, the same but with a T added to the front. I
don’t know the details of the protocol. You could try the shorter version
first and then inspect the ends of all reads that were trimmed. If all have a
trailing T, then that is probably also part of the adapter sequence.
Original comment by marcel.m...@tu-dortmund.de
on 15 May 2013 at 8:36
Thanks,
That worked. T ran FASTQC and and found that "Illumina Single End Adapter 2"
with lots of other primers were present in the sample. That's why i used that
adapter sequence.
Also, you were right about the sequence being miRNA. Its rat miRNA sample.
Thank you very much.
Original comment by tandon.a...@gmail.com
on 15 May 2013 at 1:05
Great, I’m happy I could help. Regarding my guess about it being a miRNA
dataset: I cheated by looking up the SRA accession before I answered :).
Original comment by marcel.m...@tu-dortmund.de
on 15 May 2013 at 2:26
Original issue reported on code.google.com by
tandon.a...@gmail.com
on 14 May 2013 at 8:59