no output

[70m43]

Hi thank you for your work.

This example code gives me [] as output

use minimap2::Aligner;
use std::path::Path;

fn main() {
    let ref_path = "/home/thomas/NGS/ref/hg19.fa";

    let mut aligner = Aligner::builder()
        .map_ont()
        .with_threads(8)
        .with_cigar()
        .with_index(ref_path, None)
        .expect("Unable to build index");

    let seq: Vec<u8> = b"ACTGACTCACATCGACTACGACTACTAGACACTAGACTATCGACTACTGACATCGA".to_vec();
    let alignment = aligner
        .map(&seq, false, false, None, None)
        .expect("Unable to align");
    println!("{:?}", alignment);
}

my Toml configuration is :

[package]
name = "desc_seq_2"
version = "0.1.0"
edition = "2021"

# See more keys and their definitions at https://doc.rust-lang.org/cargo/reference/manifest.html

[dependencies]
minimap2 = "0.1.16+minimap2.2.26"

cargo 1.74.0-nightly (d5336f813 2023-09-14)

[jguhlin]

Ah, that's the example in the docs. My fault. For such a short sequence you'll need .short() or .sr() instead of .map_ont().

[70m43]

Thank you but neither changing for .short() nor .sr() nor a longer sequence solve the issue.

[jguhlin]

It's possible there is no match for your sequence? Does the cli produce an output. If there are no matches the vector is empty.

On Tue, 19 Sept 2023, 8:32 pm 70m43, @.***> wrote:

Thank you but neither changing for .short() nor .sr() nor a longer sequence solve the issue.

— Reply to this email directly, view it on GitHub https://github.com/jguhlin/minimap2-rs/issues/47#issuecomment-1725060341, or unsubscribe https://github.com/notifications/unsubscribe-auth/AAOA2CFQIPPFNZ7RLTPOHOLX3FKDRANCNFSM6AAAAAA44NXHBE . You are receiving this because you commented.Message ID: @.***>

[70m43]

It's the same with the sequence from samtools faidx /home/thomas/NGS/ref/hg19.fa chr17:18573597-18573711

[70m43]

I removed with_cigar() and now it works...

Thank you for your help and work !

[jianshu93]

Hello All,

Is this problem solved? I do need Cigar for calculating identities, but the default PAF also works for me. Just wonder whether the Cigar functionality also works.

Thanks,

Jianshu