search

jh041 / msatcommander

Automatically exported from code.google.com/p/msatcommander
0 stars 0 forks source link

When not combining primers, sometimes there are duplicates (reported by Jarek Bryk) #25

Closed GoogleCodeExporter closed 8 years ago

GoogleCodeExporter commented 8 years ago 
Yet - I think - the 104 doesn't change the output thing. I have run the 104 on 
the same input sequence I sent you yesterday, and this is what I got (only 
first few columns shown):

Microsatellites:
name    records_id  id  motif   start
chr12:42011465-42047304 0   0   AC  1516
chr12:42011465-42047304 0   1   AC  1534
chr12:42011465-42047304 0   2   AC  22521
chr12:42011465-42047304 0   3   AC  22565
chr12:42011465-42047304 0   4   AT  1240

So all msats have records_id 0 and each msat has id from 0 to 5. All is well 
:-) and I expected to have primers for each records_id, id combination. Yet:

Primers (shown only for the msats id 0):
name    records_id  msats_id    primer  left    left_sequence
Potentially duplicated primers:                 
chr12:42011465-42047304 0   0   0   1204,2  ACCTGGTCCTTTCATCGGTG
chr12:42011465-42047304 0   0   0   1204,2  ACCTGGTCCTTTCATCGGTG
chr12:42011465-42047304 0   0   0   22323,2 GAGCTGACGTTTCACCAGTC
chr12:42011465-42047304 0   0   0   22323,2 GAGCTGACGTTTCACCAGTC

So here you can see that the same records_id, id combination that in the 
previous file uniqely defined each msat, now does not. In the primers output, 
records_id 0, msats_id 0 now actually seems to indicate primers for msats 
records_id 0, id 0 *or* 1 *and* 2 *or* 3.

What I expected (and think would be clearer) is for example:

name    records_id  msats_id    primer  left    left_sequence
Potentially duplicated primers:                 
chr12:42011465-42047304 0   0   0   1204,2  ACCTGGTCCTTTCATCGGTG (-> primer for msat 
id 0)
chr12:42011465-42047304 0   1   0   1204,2  ACCTGGTCCTTTCATCGGTG (-> primer for msat 
id 1)
chr12:42011465-42047304 0   2   0   22323,2 GAGCTGACGTTTCACCAGTC (-> primer for msat 
id 2)
chr12:42011465-42047304 0   3   0   22323,2 GAGCTGACGTTTCACCAGTC (-> primer for msat 
id 3... and so on)

This is the 'bug' I complained about and I AFAIK it hasn't change in 104beta.

Original issue reported on code.google.com by brant.fa...@gmail.com on 4 May 2011 at 4:24

GoogleCodeExporter commented 8 years ago 
Tests on the data above (and normal test data) indicate that the problem has 
been fixed.

Original comment by brant.fa...@gmail.com on 4 May 2011 at 5:17