search

jlab-code / MethylStar

A fast and robust pre-processing pipeline for bulk or single-cell whole-genome bisulfite sequencing (WGBS) data.
GNU General Public License v3.0
30 stars 6 forks source link

Issue with Bismark bam production #1

Closed El-Castor closed 4 years ago

El-Castor commented 4 years ago

Hi, Thanks a lot for your piepline, it's very nice and usefull. I'v launch the analysis on my proper bulk WGBS data. When I try to map on my genome using bismark ( step 3 on your pipeline) it doesn't produce bam file. The problem is taht in the log file I have no error message so I don't find the issue.

here you can see the Bismark-mapper log file output : 

Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz , Mock_FDLM202341331-1a_H3V2NDSXY_L4_unpaired_1.fq.gz and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz , Mock_FDLM202341331-1a_H3V2NDSXY_L4_unpaired_2.fq.gz
Nucleotide coverage is disabled.
Running bismark for Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz , Mock_FDLM202341331-1a_H3V2NDSXY_L4_unpaired_1.fq.gz and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz , Mock_FDLM202341331-1a_H3V2NDSXY_L4_unpaired_2.fq.gz ...
Bismark for Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz , Mock_FDLM202341331-1a_H3V2NDSXY_L4_unpaired_1.fq.gz , Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz , Mock_FDLM202341331-1a_H3V2NDSXY_L4_unpaired_2.fq.gz finished. Duration time 0 Minutes.
Mock_FDLM202341331-1a_H3V53DSXY_L2_paired_1.fq.gz , Mock_FDLM202341331-1a_H3V53DSXY_L2_unpaired_1.fq.gz and Mock_FDLM202341331-1a_H3V53DSXY_L2_paired_2.fq.gz , Mock_FDLM202341331-1a_H3V53DSXY_L2_unpaired_2.fq.gz
Nucleotide coverage is disabled.
Running bismark for Mock_FDLM202341331-1a_H3V53DSXY_L2_paired_1.fq.gz , Mock_FDLM202341331-1a_H3V53DSXY_L2_unpaired_1.fq.gz and Mock_FDLM202341331-1a_H3V53DSXY_L2_paired_2.fq.gz , Mock_FDLM202341331-1a_H3V53DSXY_L2_unpaired_2.fq.gz ...
Bismark for Mock_FDLM202341331-1a_H3V53DSXY_L2_paired_1.fq.gz , Mock_FDLM202341331-1a_H3V53DSXY_L2_unpaired_1.fq.gz , Mock_FDLM202341331-1a_H3V53DSXY_L2_paired_2.fq.gz , Mock_FDLM202341331-1a_H3V53DSXY_L2_unpaired_2.fq.gz finished. Duration time 0 Minutes.
R150mM_FDLM202341332-1a_H3V2NDSXY_L4_paired_1.fq.gz , R150mM_FDLM202341332-1a_H3V2NDSXY_L4_unpaired_1.fq.gz and R150mM_FDLM202341332-1a_H3V2NDSXY_L4_paired_2.fq.gz , R150mM_FDLM202341332-1a_H3V2NDSXY_L4_unpaired_2.fq.gz
Nucleotide coverage is disabled.
Running bismark for R150mM_FDLM202341332-1a_H3V2NDSXY_L4_paired_1.fq.gz , R150mM_FDLM202341332-1a_H3V2NDSXY_L4_unpaired_1.fq.gz and R150mM_FDLM202341332-1a_H3V2NDSXY_L4_paired_2.fq.gz , R150mM_FDLM202341332-1a_H3V2NDSXY_L4_unpaired_2.fq.gz ...
Bismark for R150mM_FDLM202341332-1a_H3V2NDSXY_L4_paired_1.fq.gz , R150mM_FDLM202341332-1a_H3V2NDSXY_L4_unpaired_1.fq.gz , R150mM_FDLM202341332-1a_H3V2NDSXY_L4_paired_2.fq.gz , R150mM_FDLM202341332-1a_H3V2NDSXY_L4_unpaired_2.fq.gz finished. Duration time 0 Minutes.
R150mM_FDLM202341332-1a_H3V53DSXY_L2_paired_1.fq.gz , R150mM_FDLM202341332-1a_H3V53DSXY_L2_unpaired_1.fq.gz and R150mM_FDLM202341332-1a_H3V53DSXY_L2_paired_2.fq.gz , R150mM_FDLM202341332-1a_H3V53DSXY_L2_unpaired_2.fq.gz
Nucleotide coverage is disabled.
Running bismark for R150mM_FDLM202341332-1a_H3V53DSXY_L2_paired_1.fq.gz , R150mM_FDLM202341332-1a_H3V53DSXY_L2_unpaired_1.fq.gz and R150mM_FDLM202341332-1a_H3V53DSXY_L2_paired_2.fq.gz , R150mM_FDLM202341332-1a_H3V53DSXY_L2_unpaired_2.fq.gz ...
Bismark for R150mM_FDLM202341332-1a_H3V53DSXY_L2_paired_1.fq.gz , R150mM_FDLM202341332-1a_H3V53DSXY_L2_unpaired_1.fq.gz , R150mM_FDLM202341332-1a_H3V53DSXY_L2_paired_2.fq.gz , R150mM_FDLM202341332-1a_H3V53DSXY_L2_unpaired_2.fq.gz finished. Duration time 0 Minutes.
Bismark Mapper finished. Duration 0 Minutes.
-- Nucleotide coverage is disabled.
-- Running bismark for Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz , Mock_FDLM202341331-1a_H3V2NDSXY_L4_unpaired_1.fq.gz and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz , Mock_FDLM202341331-1a_H3V2NDSXY_L4_unpaired_2.fq.gz ...
-- Bismark for Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz , Mock_FDLM202341331-1a_H3V2NDSXY_L4_unpaired_1.fq.gz , Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz , Mock_FDLM202341331-1a_H3V2NDSXY_L4_unpaired_2.fq.gz finished. Duration time 0 Minutes.
-- Nucleotide coverage is disabled.
-- Running bismark for Mock_FDLM202341331-1a_H3V53DSXY_L2_paired_1.fq.gz , Mock_FDLM202341331-1a_H3V53DSXY_L2_unpaired_1.fq.gz and Mock_FDLM202341331-1a_H3V53DSXY_L2_paired_2.fq.gz , Mock_FDLM202341331-1a_H3V53DSXY_L2_unpaired_2.fq.gz ...
-- Bismark for Mock_FDLM202341331-1a_H3V53DSXY_L2_paired_1.fq.gz , Mock_FDLM202341331-1a_H3V53DSXY_L2_unpaired_1.fq.gz , Mock_FDLM202341331-1a_H3V53DSXY_L2_paired_2.fq.gz , Mock_FDLM202341331-1a_H3V53DSXY_L2_unpaired_2.fq.gz finished. Duration time 0 Minutes.
-- Nucleotide coverage is disabled.
-- Running bismark for R150mM_FDLM202341332-1a_H3V2NDSXY_L4_paired_1.fq.gz , R150mM_FDLM202341332-1a_H3V2NDSXY_L4_unpaired_1.fq.gz and R150mM_FDLM202341332-1a_H3V2NDSXY_L4_paired_2.fq.gz , R150mM_FDLM202341332-1a_H3V2NDSXY_L4_unpaired_2.fq.gz ...
-- Bismark for R150mM_FDLM202341332-1a_H3V2NDSXY_L4_paired_1.fq.gz , R150mM_FDLM202341332-1a_H3V2NDSXY_L4_unpaired_1.fq.gz , R150mM_FDLM202341332-1a_H3V2NDSXY_L4_paired_2.fq.gz , R150mM_FDLM202341332-1a_H3V2NDSXY_L4_unpaired_2.fq.gz finished. Duration time 0 Minutes.
-- Nucleotide coverage is disabled.
-- Running bismark for R150mM_FDLM202341332-1a_H3V53DSXY_L2_paired_1.fq.gz , R150mM_FDLM202341332-1a_H3V53DSXY_L2_unpaired_1.fq.gz and R150mM_FDLM202341332-1a_H3V53DSXY_L2_paired_2.fq.gz , R150mM_FDLM202341332-1a_H3V53DSXY_L2_unpaired_2.fq.gz ...
-- Bismark for R150mM_FDLM202341332-1a_H3V53DSXY_L2_paired_1.fq.gz , R150mM_FDLM202341332-1a_H3V53DSXY_L2_unpaired_1.fq.gz , R150mM_FDLM202341332-1a_H3V53DSXY_L2_paired_2.fq.gz , R150mM_FDLM202341332-1a_H3V53DSXY_L2_unpaired_2.fq.gz finished. Duration time 0 Minutes.
Bismark Mapper finished. Total time 0 Minutes.

More over, I don't think that the issue it's due to the trimming because I have any error, as you can see bellow in the trimmomatic log file:

miniconda3/envs/MethylStar/share/trimmomatic-0.39-1/adapters/TruSeq3-PE.fa:1:30:9 LEADING:20 TRAILING:20 SLIDINGWINDOW:4:20 MINLEN:36
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Read Pairs: 1082395 Both Surviving: 970010 (89,62%) Forward Only Surviving: 51654 (4,77%) Reverse Only Surviving: 38125 (3,52%) Dropped: 22606 (2,09%)
TrimmomaticPE: Completed successfully

my session info : 

# Name                    Version                   Build  Channel
_libgcc_mutex             0.1                 conda_forge    conda-forge
_openmp_mutex             4.5                       0_gnu    conda-forge
_r-mutex                  1.0.0                     mro_2    r
alsa-lib                  1.1.5             h516909a_1002    conda-forge
bedtools                  2.29.2               hc088bd4_0    bioconda
binutils_impl_linux-64    2.34                 h53a641e_4    conda-forge
binutils_linux-64         2.34                hc952b39_20    conda-forge
bismark                   0.22.3                        0    bioconda
bowtie2                   2.3.5.1          py27he513fc3_0    bioconda
bzip2                     1.0.8                h516909a_2    conda-forge
ca-certificates           2020.4.5.1           hecc5488_0    conda-forge
cairo                     1.16.0            h3fc0475_1004    conda-forge
certifi                   2019.11.28       py27h8c360ce_1    conda-forge
curl                      7.69.1               h33f0ec9_0    conda-forge
fastqc                    0.11.9                        0    bioconda
font-ttf-dejavu-sans-mono 2.37                 hab24e00_0    conda-forge
fontconfig                2.13.1            h1056068_1002    conda-forge
freetype                  2.10.2               he06d7ca_0    conda-forge
fribidi                   1.0.9                h516909a_0    conda-forge
gcc_impl_linux-64         7.5.0                hd420e75_6    conda-forge
gcc_linux-64              7.5.0               h09487f9_20    conda-forge
gettext                   0.19.8.1          hc5be6a0_1002    conda-forge
gfortran_impl_linux-64    7.5.0                hdf63c60_6    conda-forge
gfortran_linux-64         7.5.0               h09487f9_20    conda-forge
giflib                    5.2.1                h516909a_2    conda-forge
glib                      2.64.3               h6f030ca_0    conda-forge
graphite2                 1.3.13            he1b5a44_1001    conda-forge
gxx_impl_linux-64         7.5.0                hdf63c60_6    conda-forge
gxx_linux-64              7.5.0               h09487f9_20    conda-forge
harfbuzz                  2.4.0                hee91db6_4    conda-forge
hisat2                    2.2.0            py27he1b5a44_1    bioconda
htslib                    1.9                  h4da6232_3    bioconda
icu                       67.1                 he1b5a44_0    conda-forge
jpeg                      9d                   h516909a_0    conda-forge
krb5                      1.17.1               h2fd8d38_0    conda-forge
lcms2                     2.9                  hbd6801e_2    conda-forge
ld_impl_linux-64          2.34                 h53a641e_4    conda-forge
libcurl                   7.69.1               hf7181ac_0    conda-forge
libdeflate                1.2                  h516909a_1    bioconda
libedit                   3.1.20191231         h46ee950_0    conda-forge
libffi                    3.2.1             he1b5a44_1007    conda-forge
libgcc-ng                 9.2.0                h24d8f2e_2    conda-forge
libgfortran-ng            7.5.0                hdf63c60_6    conda-forge
libgomp                   9.2.0                h24d8f2e_2    conda-forge
libiconv                  1.15              h516909a_1006    conda-forge
libpng                    1.6.37               hed695b0_1    conda-forge
libssh2                   1.9.0                hab1572f_2    conda-forge
libstdcxx-ng              9.2.0                hdf63c60_2    conda-forge
libtiff                   4.1.0                hc7e4089_6    conda-forge
libuuid                   2.32.1            h14c3975_1000    conda-forge
libwebp-base              1.1.0                h516909a_3    conda-forge
libxcb                    1.13              h14c3975_1002    conda-forge
libxml2                   2.9.10               h72b56ed_1    conda-forge
lz4-c                     1.9.2                he1b5a44_1    conda-forge
make                      4.3                  h516909a_0    conda-forge
mro-base                  3.5.0                h1c2f66e_0    R
mro-basics                3.5.0                         0    R
ncurses                   6.1               hf484d3e_1002    conda-forge
openjdk                   11.0.1            h600c080_1018    conda-forge
openssl                   1.1.1g               h516909a_0    conda-forge
pango                     1.42.4               h7062337_4    conda-forge
pcre                      8.44                 he1b5a44_0    conda-forge
perl                      5.26.2            h516909a_1006    conda-forge
pip                       20.1.1             pyh9f0ad1d_0    conda-forge
pixman                    0.38.0            h516909a_1003    conda-forge
pthread-stubs             0.4               h14c3975_1001    conda-forge
python                    2.7.15          h5a48372_1011_cpython    conda-forge
python_abi                2.7                    1_cp27mu    conda-forge
r                         3.5.0                  mro350_0    R
r-boot                    1.3_20                 mro350_0    r
r-checkpoint              0.4.4                  mro350_0    r
r-class                   7.3_14                 mro350_0    r
r-cluster                 2.0.7_1                mro350_0    r
r-codetools               0.2_15                 mro350_0    r
r-curl                    3.2                    mro350_0    r
r-deployrrserve           9.0.0                  mro350_0    r
r-doparallel              1.0.13                 mro350_0    r
r-foreach                 1.5.0                  mro350_0    r
r-foreign                 0.8_70                 mro350_0    r
r-iterators               1.0.10                 mro350_0    r
r-jsonlite                1.5                    mro350_0    r
r-kernsmooth              2.23_15                mro350_0    r
r-lattice                 0.20_35                mro350_0    r
r-mass                    7.3_49                 mro350_0    r
r-matrix                  1.2_14                 mro350_0    r
r-mgcv                    1.8_23                 mro350_0    r
r-microsoftr              3.5.0.108              mro350_0    r
r-nlme                    3.1_137                mro350_0    r
r-nnet                    7.3_12                 mro350_0    r
r-png                     0.1_7                  mro350_0    r
r-r6                      2.2.2                  mro350_0    r
r-recommended             3.5.0                  mro350_0    R
r-revoioq                 10.0.0                 mro350_0    r
r-revomods                11.0.0                 mro350_0    r
r-revoutilsmath           11.0.0                 mro350_0    r
r-rpart                   4.1_13                 mro350_0    r
r-runit                   0.4.26                 mro350_0    r
r-spatial                 7.3_11                 mro350_0    r
r-survival                2.41_3                 mro350_0    r
readline                  8.0                  hf8c457e_0    conda-forge
samtools                  1.9                 h10a08f8_12    bioconda
setuptools                44.0.0                   py27_0    conda-forge
sqlite                    3.30.1               hcee41ef_0    conda-forge
sysroot_linux-64          2.12                 h3a0023d_5    conda-forge
tbb                       2020.1               hc9558a2_0    conda-forge
tk                        8.6.10               hed695b0_0    conda-forge
trimmomatic               0.39                          1    bioconda
wheel                     0.34.2                     py_1    conda-forge
xorg-fixesproto           5.0               h14c3975_1002    conda-forge
xorg-inputproto           2.3.2             h14c3975_1002    conda-forge
xorg-kbproto              1.0.7             h14c3975_1002    conda-forge
xorg-libice               1.0.10               h516909a_0    conda-forge
xorg-libsm                1.2.3             h84519dc_1000    conda-forge
xorg-libx11               1.6.9                h516909a_0    conda-forge
xorg-libxau               1.0.9                h14c3975_0    conda-forge
xorg-libxdmcp             1.1.3                h516909a_0    conda-forge
xorg-libxext              1.3.4                h516909a_0    conda-forge
xorg-libxfixes            5.0.3             h516909a_1004    conda-forge
xorg-libxi                1.7.10               h516909a_0    conda-forge
xorg-libxrender           0.9.10            h516909a_1002    conda-forge
xorg-libxtst              1.2.3             h516909a_1002    conda-forge
xorg-recordproto          1.14.2            h516909a_1002    conda-forge
xorg-renderproto          0.11.1            h14c3975_1002    conda-forge
xorg-xextproto            7.3.0             h14c3975_1002    conda-forge
xorg-xproto               7.0.31            h14c3975_1007    conda-forge
xz                        5.2.5                h516909a_0    conda-forge
zlib                      1.2.11            h516909a_1006    conda-forge
zstd                      1.4.4                h6597ccf_3    conda-forge

Do you have any idea to resolve the issue? Thanks in Advance

shahryary commented 4 years ago

Thank you very much @El-Castor for your comments, seems there is some issue with Bismark Mapper. I need some logs to look closely to solve this issue, Could you please submit these logs here: 1- What is the reference genome? 2- Please copy log file (.log and .txt) from /YOUR_RESULT_Folder/bismark-mappers/ directory (one of the sample is sufficient). 3- it would be great if you send your configuration file too, you can find it under MethylStar directory config/pipeline.conf

El-Castor commented 4 years ago

Hi Shahryary,

Yes, I think too. Because I see all the ftmp files produce by bismark but when it should to produce the bam it has an error, as you cans see bellow :

---------------------------------------------------------------------------

    *** Running Bismark Mapper Part ***

Configuration summary: 

- Bismark location: /opt/share/FLOCAD/userspace/cpichot/miniconda3/envs/MethylStar/bin/
   -- scBS-Seq (--pbat)?Disabled
   -- Nucleotide: Disabled
   -- Buffer size: 40
   -- Number of Parallel: 8 
- Reference Genome is: /K/FLOCAD/DATA/OMICS/Melon/DNAseq/AdnaneB/Genome_PacBio/toulouse_assemblage/CMiso1.1/20180606/CMiso1.1_genome.fa
- Parallel mode: Disabled
- Bismark run in pair mode: Disabled

Note: Fastq bam report will be start after bismark mapper.

Do you want continue to run? [y/n] y

Running Bismark Mapper ...

Starting Bismark mapper ...

No changes in Ref.genome.
Genome Type: Others 

-- Nucleotide coverage is disabled.
-- Running bismark for Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz ...
Bismark for Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz finished. Duration time 0 Minutes.
-------------------------------------------- 

-- Nucleotide coverage is disabled.
-- Running bismark for Mock_FDLM202341331-1a_H3V53DSXY_L2_paired_1.fq.gz and Mock_FDLM202341331-1a_H3V53DSXY_L2_paired_2.fq.gz ...
Bismark for Mock_FDLM202341331-1a_H3V53DSXY_L2_paired_1.fq.gz and Mock_FDLM202341331-1a_H3V53DSXY_L2_paired_2.fq.gz finished. Duration time 20 Minutes.
-------------------------------------------- 

-- Nucleotide coverage is disabled.
-- Running bismark for R150mM_FDLM202341332-1a_H3V2NDSXY_L4_paired_1.fq.gz and R150mM_FDLM202341332-1a_H3V2NDSXY_L4_paired_2.fq.gz ...
Bismark for R150mM_FDLM202341332-1a_H3V2NDSXY_L4_paired_1.fq.gz and R150mM_FDLM202341332-1a_H3V2NDSXY_L4_paired_2.fq.gz finished. Duration time 0 Minutes.
-------------------------------------------- 

-- Nucleotide coverage is disabled.
-- Running bismark for R150mM_FDLM202341332-1a_H3V53DSXY_L2_paired_1.fq.gz and R150mM_FDLM202341332-1a_H3V53DSXY_L2_paired_2.fq.gz ...
Bismark for R150mM_FDLM202341332-1a_H3V53DSXY_L2_paired_1.fq.gz and R150mM_FDLM202341332-1a_H3V53DSXY_L2_paired_2.fq.gz finished. Duration time 16 Minutes.
-------------------------------------------- 

Bismark Mapper done. Total running time 36 Minutes.
ls: impossible d'accéder à '/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/*.bam': Aucun fichier ou dossier de ce type
ls: impossible d'accéder à '/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/*nucleotide_stats.txt': Aucun fichier ou dossier de ce type
./src/bash/bismark-mapper-pair.sh: ligne 129 : [: trop d'arguments
ls: impossible d'accéder à '/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/*.bam': Aucun fichier ou dossier de ce type

 Starting QC-Bam-report ...
Running in single mode!(parallel disabled.) 

You can find the result in /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/qc-bam-reports folder.
sort: impossible de lire: /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/qc-bam-reports/list-finished.lst: Aucun fichier ou dossier de ce type
rm: impossible de supprimer '/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/qc-bam-reports/list-finished.lst': Aucun fichier ou dossier de ce type
Sorting bam files & generating coverage report...  
(535, '5.7.8 Username and Password not accepted. Learn more at\n5.7.8  https://support.google.com/mail/?p=BadCredentials j16sm10168634wre.21 - gsmtp')
Something went wrong...
something is going wrong... please run again. 

Please, press ENTER to continue ...

To respond to your question:

1- I used a custom genome that is not avaible in your pipeline. I have do the genome configuration in MethylStar configuration menu.

2- here is the bismark log file from one file : 

Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.3.5])
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/opt/share/FLOCAD/userspace/cpichot/miniconda3/envs/MethylStar/bin/samtools'
Reference genome folder provided is /K/FLOCAD/DATA/OMICS/Melon/DNAseq/AdnaneB/Genome_PacBio/toulouse_assemblage/CMiso1.1/20180606/  (absolute path is '/ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/DATA/OMICS/Melon/DNAseq/AdnaneB/Genome_PacBio/toulouse_assemblage/CMiso1.1/20180606/)'
FastQ format assumed (by default)
Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary!

Input files to be analysed (in current folder '/ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers'):
/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz
/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz
Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Output will be written into the directory: /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/
Summary of all aligner options: -q -N 0 -L 20 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500
Running Bismark Parallel version. Number of parallel instances to be spawned: 2

Current working directory is: /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers

Now reading in and storing sequence information of the genome specified in: /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/DATA/OMICS/Melon/DNAseq/AdnaneB/Genome_PacBio/toulouse_assemblage/CMiso1.1/20180606/

chr CMiso1.1chr00 (3219671 bp)
chr CMiso1.1chr01 (35819275 bp)
chr CMiso1.1chr02 (24717502 bp)
chr CMiso1.1chr03 (29901275 bp)
chr CMiso1.1chr04 (36545425 bp)
chr CMiso1.1chr05 (29172381 bp)
chr CMiso1.1chr06 (36200319 bp)
chr CMiso1.1chr07 (26767028 bp)
chr CMiso1.1chr08 (33813569 bp)
chr CMiso1.1chr09 (23958596 bp)
chr CMiso1.1chr10 (24822432 bp)
chr CMiso1.1chr11 (33524158 bp)
chr CMiso1.1chr12 (26620111 bp)

Paired-end alignments will be performed
=======================================

The provided filenames for paired-end alignments are /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz and /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz

Paired-end alignments will be performed
=======================================

The provided filenames for paired-end alignments are /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz and /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz

gzip: stdout: Broken pipe

gzip: stdout: Broken pipe
Finished subdividing /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz for PID: 22775 and offset 2 (sequences written out: 0)

Using the subset file >Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2< as new in-file 1 (instead of >/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz<)
Finished subdividing /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz for PID: 0 and offset 1 (sequences written out: 0)

Using the subset file >Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1< as new in-file 1 (instead of >/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz<)

gzip: stdout: Broken pipe

gzip: stdout: Broken pipe
Finished subdividing /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz for PID: 22775 and offset 2 (sequences written out: 0)

Using the subset file >Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2< as new in-file 2 (instead of >/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz<)
Input files are in FastQ format
Finished subdividing /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz for PID: 0 and offset 1 (sequences written out: 0)

Using the subset file >Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1< as new in-file 2 (instead of >/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz<)
Input files are in FastQ format
Writing a C -> T converted version of the input file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2 to Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_C_to_T.fastq
Writing a C -> T converted version of the input file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1 to Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_C_to_T.fastq

Created C -> T converted version of the FastQ file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2 (0 sequences in total)

Created C -> T converted version of the FastQ file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1 (0 sequences in total)

Writing a G -> A converted version of the input file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2 to Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2_G_to_A.fastq
Writing a G -> A converted version of the input file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1 to Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1_G_to_A.fastq

Created G -> A converted version of the FastQ file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2 (0 sequences in total)

Input files are Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2_G_to_A.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/DATA/OMICS/Melon/DNAseq/AdnaneB/Genome_PacBio/toulouse_assemblage/CMiso1.1/20180606/ with the specified options: -q -N 0 -L 20 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500

Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2_G_to_A.fastq, with the options: -q -N 0 -L 20 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc))

Created G -> A converted version of the FastQ file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1 (0 sequences in total)

Input files are Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1_G_to_A.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/DATA/OMICS/Melon/DNAseq/AdnaneB/Genome_PacBio/toulouse_assemblage/CMiso1.1/20180606/ with the specified options: -q -N 0 -L 20 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500

Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1_G_to_A.fastq, with the options: -q -N 0 -L 20 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc))
sh: 1: Syntax error: "(" unexpected
Found no alignment, assigning undef to last_seq_id and last_lines
Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2_G_to_A.fastq, with the options: -q -N 0 -L 20 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw))
sh: 1: Syntax error: "(" unexpected
Found no alignment, assigning undef to last_seq_id and last_lines
Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1_G_to_A.fastq, with the options: -q -N 0 -L 20 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw))
sh: 1: Syntax error: "(" unexpected
Found no alignment, assigning undef to last_seq_id and last_lines
sh: 1: Syntax error: "(" unexpected
Found no alignment, assigning undef to last_seq_id and last_lines

>>> Writing bisulfite mapping results to Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_pe.bam <<<

sh: 1: Syntax error: "(" unexpected

>>> Writing bisulfite mapping results to Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_pe.bam <<<

sh: 1: Syntax error: "(" unexpected

Reading in the sequence files Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2 and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2
Processed 0 sequences in total

Failed to close filehandle OUT: Broken pipe

Reading in the sequence files Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1 and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1
Processed 0 sequences in total

Failed to close filehandle OUT: Broken pipe

Successfully deleted the temporary files Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2_G_to_A.fastq

Final Alignment report
======================
Sequence pairs analysed in total:   0
Number of paired-end alignments with a unique best hit: 0
Mapping efficiency: 0%

Sequence pairs with no alignments under any condition:  0
Sequence pairs did not map uniquely:    0
Sequence pairs which were discarded because genomic sequence could not be extracted:    0

Number of sequence pairs with unique best (first) alignment came from the bowtie output:
CT/GA/CT:   0   ((converted) top strand)
GA/CT/CT:   0   (complementary to (converted) top strand)
GA/CT/GA:   0   (complementary to (converted) bottom strand)
CT/GA/GA:   0   ((converted) bottom strand)

Number of alignments to (merely theoretical) complementary strands being rejected in total: 0

Final Cytosine Methylation Report
=================================
Total number of C's analysed:   0

Total methylated C's in CpG context:    0
Total methylated C's in CHG context:    0
Total methylated C's in CHH context:    0
Total methylated C's in Unknown context:    0

Total unmethylated C's in CpG context:  0
Total unmethylated C's in CHG context:  0
Total unmethylated C's in CHH context:  0
Total unmethylated C's in Unknown context:  0

Can't determine percentage of methylated Cs in CpG context if value was 0
Can't determine percentage of methylated Cs in CHG context if value was 0
Can't determine percentage of methylated Cs in CHH context if value was 0
Can't determine percentage of methylated Cs in unknown context (CN or CHN) if value was 0

Now waiting for all child processes to complete

Successfully deleted the temporary files Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1_G_to_A.fastq

Final Alignment report
======================
Sequence pairs analysed in total:   0
Number of paired-end alignments with a unique best hit: 0
Mapping efficiency: 0%

Sequence pairs with no alignments under any condition:  0
Sequence pairs did not map uniquely:    0
Sequence pairs which were discarded because genomic sequence could not be extracted:    0

Number of sequence pairs with unique best (first) alignment came from the bowtie output:
CT/GA/CT:   0   ((converted) top strand)
GA/CT/CT:   0   (complementary to (converted) top strand)
GA/CT/GA:   0   (complementary to (converted) bottom strand)
CT/GA/GA:   0   ((converted) bottom strand)

Number of alignments to (merely theoretical) complementary strands being rejected in total: 0

Final Cytosine Methylation Report
=================================
Total number of C's analysed:   0

Total methylated C's in CpG context:    0
Total methylated C's in CHG context:    0
Total methylated C's in CHH context:    0
Total methylated C's in Unknown context:    0

Total unmethylated C's in CpG context:  0
Total unmethylated C's in CHG context:  0
Total unmethylated C's in CHH context:  0
Total unmethylated C's in Unknown context:  0

Can't determine percentage of methylated Cs in CpG context if value was 0
Can't determine percentage of methylated Cs in CHG context if value was 0
Can't determine percentage of methylated Cs in CHH context if value was 0
Can't determine percentage of methylated Cs in unknown context (CN or CHN) if value was 0

Right, cleaning up now...

Deleting temporary sequence files...
Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1    Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1    Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2    Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2    

Now merging BAM files Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_pe.bam Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_pe.bam into >>> Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1_bismark_bt2_pe.bam <<<
Merging from file >> Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_pe.bam <<
sh: 1: Syntax error: "(" unexpected
sh: 1: Syntax error: "(" unexpected
Failed to close filehandle
Merging from file >> Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_pe.bam <<
sh: 1: Syntax error: "(" unexpected
Failed to close filehandle

Failed to close output filehandle

Deleting temporary BAM files...
/ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_pe.bam  Failed to delete temporary BAM file /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_pe.bam: No such file or directory
/ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_pe.bam  Failed to delete temporary BAM file /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_pe.bam: No such file or directory

Writing report to /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1_bismark_bt2_PE_report.txt
Now merging temporary reports Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_PE_report.txt Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_PE_report.txt into >>> /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1_bismark_bt2_PE_report.txt <<<
Merging from file >> Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_PE_report.txt <<
Merging from file >> Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_PE_report.txt <<

Printing a final merged alignment report for all individual sub-reports

Final Alignment report
======================
Sequence pairs analysed in total:   0
Number of paired-end alignments with a unique best hit: 0
Mapping efficiency: 0%

Sequence pairs with no alignments under any condition:  0
Sequence pairs did not map uniquely:    0
Sequence pairs which were discarded because genomic sequence could not be extracted:    0

Number of sequence pairs with unique best (first) alignment came from the bowtie output:
CT/GA/CT:   0   ((converted) top strand)
GA/CT/CT:   0   (complementary to (converted) top strand)
GA/CT/GA:   0   (complementary to (converted) bottom strand)
CT/GA/GA:   0   ((converted) bottom strand)

Number of alignments to (merely theoretical) complementary strands being rejected in total: 0

Final Cytosine Methylation Report
=================================
Total number of C's analysed:   0

Total methylated C's in CpG context:    0
Total methylated C's in CHG context:    0
Total methylated C's in CHH context:    0
Total methylated C's in Unknown context:    0

Total unmethylated C's in CpG context:  0
Total unmethylated C's in CHG context:  0
Total unmethylated C's in CHH context:  0
Total unmethylated C's in Unknown context:  0

Can't determine percentage of methylated Cs in CpG context if value was 0
Can't determine percentage of methylated Cs in CHG context if value was 0
Can't determine percentage of methylated Cs in CHH context if value was 0
Can't determine percentage of methylated Cs in unknown context (CN or CHN) if value was 0

Deleting temporary report files...
Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_PE_report.txt  Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_PE_report.txt  

Bismark completed in 0d 0h 0m 8s

====================
Bismark run complete
====================

Bowtie 2 seems to be working fine (tested command 'bowtie2 --version' [2.3.5])
Output format is BAM (default)
Alignments will be written out in BAM format. Samtools found here: '/opt/share/FLOCAD/userspace/cpichot/miniconda3/envs/MethylStar/bin/samtools'
Reference genome folder provided is /K/FLOCAD/DATA/OMICS/Melon/DNAseq/AdnaneB/Genome_PacBio/toulouse_assemblage/CMiso1.1/20180606/  (absolute path is '/ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/DATA/OMICS/Melon/DNAseq/AdnaneB/Genome_PacBio/toulouse_assemblage/CMiso1.1/20180606/)'
FastQ format assumed (by default)
Each Bowtie 2 instance is going to be run with 2 threads. Please monitor performance closely and tune down if necessary!

Input files to be analysed (in current folder '/ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers'):
/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz
/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz
Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Output will be written into the directory: /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/
Summary of all aligner options: -q -N 0 -L 20 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500
Running Bismark Parallel version. Number of parallel instances to be spawned: 2

Current working directory is: /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers

Now reading in and storing sequence information of the genome specified in: /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/DATA/OMICS/Melon/DNAseq/AdnaneB/Genome_PacBio/toulouse_assemblage/CMiso1.1/20180606/

chr CMiso1.1chr00 (3219671 bp)
chr CMiso1.1chr01 (35819275 bp)
chr CMiso1.1chr02 (24717502 bp)
chr CMiso1.1chr03 (29901275 bp)
chr CMiso1.1chr04 (36545425 bp)
chr CMiso1.1chr05 (29172381 bp)
chr CMiso1.1chr06 (36200319 bp)
chr CMiso1.1chr07 (26767028 bp)
chr CMiso1.1chr08 (33813569 bp)
chr CMiso1.1chr09 (23958596 bp)
chr CMiso1.1chr10 (24822432 bp)
chr CMiso1.1chr11 (33524158 bp)
chr CMiso1.1chr12 (26620111 bp)

Paired-end alignments will be performed
=======================================

The provided filenames for paired-end alignments are /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz and /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz

Paired-end alignments will be performed
=======================================

The provided filenames for paired-end alignments are /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz and /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz

gzip: stdout: Broken pipe

gzip: stdout: Broken pipe
Finished subdividing /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz for PID: 25844 and offset 2 (sequences written out: 0)

Using the subset file >Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2< as new in-file 1 (instead of >/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz<)
Finished subdividing /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz for PID: 0 and offset 1 (sequences written out: 0)

Using the subset file >Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1< as new in-file 1 (instead of >/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz<)

gzip: stdout: Broken pipe

gzip: stdout: Broken pipe
Finished subdividing /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz for PID: 25844 and offset 2 (sequences written out: 0)

Using the subset file >Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2< as new in-file 2 (instead of >/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz<)
Input files are in FastQ format
Finished subdividing /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz for PID: 0 and offset 1 (sequences written out: 0)

Using the subset file >Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1< as new in-file 2 (instead of >/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz<)
Input files are in FastQ format
Writing a C -> T converted version of the input file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2 to Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_C_to_T.fastq
Writing a C -> T converted version of the input file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1 to Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_C_to_T.fastq

Created C -> T converted version of the FastQ file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2 (0 sequences in total)

Created C -> T converted version of the FastQ file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1 (0 sequences in total)

Writing a G -> A converted version of the input file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2 to Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2_G_to_A.fastq
Writing a G -> A converted version of the input file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1 to Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1_G_to_A.fastq

Created G -> A converted version of the FastQ file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2 (0 sequences in total)

Input files are Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2_G_to_A.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/DATA/OMICS/Melon/DNAseq/AdnaneB/Genome_PacBio/toulouse_assemblage/CMiso1.1/20180606/ with the specified options: -q -N 0 -L 20 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500

Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2_G_to_A.fastq, with the options: -q -N 0 -L 20 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc))

Created G -> A converted version of the FastQ file Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1 (0 sequences in total)

Input files are Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1_G_to_A.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/DATA/OMICS/Melon/DNAseq/AdnaneB/Genome_PacBio/toulouse_assemblage/CMiso1.1/20180606/ with the specified options: -q -N 0 -L 20 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500

Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1_G_to_A.fastq, with the options: -q -N 0 -L 20 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc))
sh: 1: Syntax error: "(" unexpected
Found no alignment, assigning undef to last_seq_id and last_lines
Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2_G_to_A.fastq, with the options: -q -N 0 -L 20 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw))
sh: 1: Syntax error: "(" unexpected
Found no alignment, assigning undef to last_seq_id and last_lines
Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1_G_to_A.fastq, with the options: -q -N 0 -L 20 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw))
sh: 1: Syntax error: "(" unexpected
Found no alignment, assigning undef to last_seq_id and last_lines
sh: 1: Syntax error: "(" unexpected
Found no alignment, assigning undef to last_seq_id and last_lines

>>> Writing bisulfite mapping results to Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_pe.bam <<<

sh: 1: Syntax error: "(" unexpected

>>> Writing bisulfite mapping results to Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_pe.bam <<<

sh: 1: Syntax error: "(" unexpected

Reading in the sequence files Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2 and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2
Processed 0 sequences in total

Failed to close filehandle OUT: Broken pipe

Reading in the sequence files Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1 and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1
Processed 0 sequences in total

Failed to close filehandle OUT: Broken pipe

Successfully deleted the temporary files Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2_G_to_A.fastq

Final Alignment report
======================
Sequence pairs analysed in total:   0
Number of paired-end alignments with a unique best hit: 0
Mapping efficiency: 0%

Sequence pairs with no alignments under any condition:  0
Sequence pairs did not map uniquely:    0
Sequence pairs which were discarded because genomic sequence could not be extracted:    0

Number of sequence pairs with unique best (first) alignment came from the bowtie output:
CT/GA/CT:   0   ((converted) top strand)
GA/CT/CT:   0   (complementary to (converted) top strand)
GA/CT/GA:   0   (complementary to (converted) bottom strand)
CT/GA/GA:   0   ((converted) bottom strand)

Number of alignments to (merely theoretical) complementary strands being rejected in total: 0

Final Cytosine Methylation Report
=================================
Total number of C's analysed:   0

Total methylated C's in CpG context:    0
Total methylated C's in CHG context:    0
Total methylated C's in CHH context:    0
Total methylated C's in Unknown context:    0

Total unmethylated C's in CpG context:  0
Total unmethylated C's in CHG context:  0
Total unmethylated C's in CHH context:  0
Total unmethylated C's in Unknown context:  0

Can't determine percentage of methylated Cs in CpG context if value was 0
Can't determine percentage of methylated Cs in CHG context if value was 0
Can't determine percentage of methylated Cs in CHH context if value was 0
Can't determine percentage of methylated Cs in unknown context (CN or CHN) if value was 0

Now waiting for all child processes to complete

Successfully deleted the temporary files Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1_G_to_A.fastq

Final Alignment report
======================
Sequence pairs analysed in total:   0
Number of paired-end alignments with a unique best hit: 0
Mapping efficiency: 0%

Sequence pairs with no alignments under any condition:  0
Sequence pairs did not map uniquely:    0
Sequence pairs which were discarded because genomic sequence could not be extracted:    0

Number of sequence pairs with unique best (first) alignment came from the bowtie output:
CT/GA/CT:   0   ((converted) top strand)
GA/CT/CT:   0   (complementary to (converted) top strand)
GA/CT/GA:   0   (complementary to (converted) bottom strand)
CT/GA/GA:   0   ((converted) bottom strand)

Number of alignments to (merely theoretical) complementary strands being rejected in total: 0

Final Cytosine Methylation Report
=================================
Total number of C's analysed:   0

Total methylated C's in CpG context:    0
Total methylated C's in CHG context:    0
Total methylated C's in CHH context:    0
Total methylated C's in Unknown context:    0

Total unmethylated C's in CpG context:  0
Total unmethylated C's in CHG context:  0
Total unmethylated C's in CHH context:  0
Total unmethylated C's in Unknown context:  0

Can't determine percentage of methylated Cs in CpG context if value was 0
Can't determine percentage of methylated Cs in CHG context if value was 0
Can't determine percentage of methylated Cs in CHH context if value was 0
Can't determine percentage of methylated Cs in unknown context (CN or CHN) if value was 0

Right, cleaning up now...

Deleting temporary sequence files...
Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1    Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1    Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2    Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2    

Now merging BAM files Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_pe.bam Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_pe.bam into >>> Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1_bismark_bt2_pe.bam <<<
Merging from file >> Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_pe.bam <<
sh: 1: Syntax error: "(" unexpected
sh: 1: Syntax error: "(" unexpected
Failed to close filehandle
Merging from file >> Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_pe.bam <<
sh: 1: Syntax error: "(" unexpected
Failed to close filehandle

Failed to close output filehandle

Deleting temporary BAM files...
/ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_pe.bam  Failed to delete temporary BAM file /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_pe.bam: No such file or directory
/ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_pe.bam  Failed to delete temporary BAM file /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_pe.bam: No such file or directory

Writing report to /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1_bismark_bt2_PE_report.txt
Now merging temporary reports Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_PE_report.txt Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_PE_report.txt into >>> /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1_bismark_bt2_PE_report.txt <<<
Merging from file >> Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_PE_report.txt <<
Merging from file >> Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_PE_report.txt <<

Printing a final merged alignment report for all individual sub-reports

Final Alignment report
======================
Sequence pairs analysed in total:   0
Number of paired-end alignments with a unique best hit: 0
Mapping efficiency: 0%

Sequence pairs with no alignments under any condition:  0
Sequence pairs did not map uniquely:    0
Sequence pairs which were discarded because genomic sequence could not be extracted:    0

Number of sequence pairs with unique best (first) alignment came from the bowtie output:
CT/GA/CT:   0   ((converted) top strand)
GA/CT/CT:   0   (complementary to (converted) top strand)
GA/CT/GA:   0   (complementary to (converted) bottom strand)
CT/GA/GA:   0   ((converted) bottom strand)

Number of alignments to (merely theoretical) complementary strands being rejected in total: 0

Final Cytosine Methylation Report
=================================
Total number of C's analysed:   0

Total methylated C's in CpG context:    0
Total methylated C's in CHG context:    0
Total methylated C's in CHH context:    0
Total methylated C's in Unknown context:    0

Total unmethylated C's in CpG context:  0
Total unmethylated C's in CHG context:  0
Total unmethylated C's in CHH context:  0
Total unmethylated C's in Unknown context:  0

Can't determine percentage of methylated Cs in CpG context if value was 0
Can't determine percentage of methylated Cs in CHG context if value was 0
Can't determine percentage of methylated Cs in CHH context if value was 0
Can't determine percentage of methylated Cs in unknown context (CN or CHN) if value was 0

Deleting temporary report files...
Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_bismark_bt2_PE_report.txt  Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_bismark_bt2_PE_report.txt  

Bismark completed in 0d 0h 0m 8s

====================
Bismark run complete
====================

here the bismark mapper txt file:

Bismark report for: /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz and /K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz (version: v0.22.3)
Bismark was run with Bowtie 2 against the bisulfite genome of /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/DATA/OMICS/Melon/DNAseq/AdnaneB/Genome_PacBio/toulouse_assemblage/CMiso1.1/20180606/ with the specified options: -q -N 1 -L 32 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500
Option '--directional' specified (default mode): alignments to complementary strands (CTOT, CTOB) were ignored (i.e. not performed)

Final Alignment report
======================
Sequence pairs analysed in total:   970010
Number of paired-end alignments with a unique best hit: 0
Mapping efficiency: 0.0% 
Sequence pairs with no alignments under any condition:  970010
Sequence pairs did not map uniquely:    0
Sequence pairs which were discarded because genomic sequence could not be extracted:    0

Number of sequence pairs with unique best (first) alignment came from the bowtie output:
CT/GA/CT:   0   ((converted) top strand)
GA/CT/CT:   0   (complementary to (converted) top strand)
GA/CT/GA:   0   (complementary to (converted) bottom strand)
CT/GA/GA:   0   ((converted) bottom strand)

Number of alignments to (merely theoretical) complementary strands being rejected in total: 0

Final Cytosine Methylation Report
=================================
Total number of C's analysed:   0

Total methylated C's in CpG context:    0
Total methylated C's in CHG context:    0
Total methylated C's in CHH context:    0
Total methylated C's in Unknown context:    0

Total unmethylated C's in CpG context:  0
Total unmethylated C's in CHG context:  0
Total unmethylated C's in CHH context:  0
Total unmethylated C's in Unknown context:  0

Can't determine percentage of methylated Cs in CpG context if value was 0
Can't determine percentage of methylated Cs in CHG context if value was 0
Can't determine percentage of methylated Cs in CHH context if value was 0
Can't determine percentage of methylated Cs in unknown context (CN or CHN) if value was 0

Bismark completed in 0d 0h 0m 42s

3- config file :

[GENERAL]
firstRun=false
currversion=1.1
raw_dataset=/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/data/Zebularine_treatment
result_pipeline=/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out
genome_ref=/K/FLOCAD/DATA/OMICS/Melon/DNAseq/AdnaneB/Genome_PacBio/toulouse_assemblage/CMiso1.1/20180606
genome_name=CMiso1.1_genome.fa
genome_type=Others
docker_mode=false
parallel_mode=false
npar=0
fastq_path=/opt/share/FLOCAD/userspace/cpichot/miniconda3/envs/MethylStar/opt/fastqc-0.11.9/fastqc
number_of_dataset=8
dataset_size=4.0
pairs_mode=true
first_pattern=_1.fq.gz
secnd_pattern=_2.fq.gz

[Trimmomatic]
java_path=/usr/bin/java
trim_path=/opt/share/FLOCAD/userspace/cpichot/miniconda3/envs/MethylStar/share/trimmomatic-0.39-1
trim_jar=/opt/share/FLOCAD/userspace/cpichot/miniconda3/envs/MethylStar/share/trimmomatic-0.39-1/trimmomatic.jar
dir_adap=$trim_path/adapters
name_adap=/opt/share/FLOCAD/userspace/cpichot/miniconda3/envs/MethylStar/share/trimmomatic-0.39-1/adapters/TruSeq3-PE.fa
end_mode=PE
ill_clip=1:30:9
LEADING=20
TRAILING=20
SLIDINGWINDOW=4:20
MINLEN=36
n_th=8

[Bismark]
bismark_path=/opt/share/FLOCAD/userspace/cpichot/miniconda3/envs/MethylStar/bin/
samtools_path=/bin/samtools
bedtools_path=/opt/share/FLOCAD/userspace/cpichot/miniconda3/envs/MethylStar/bin/bedtools
modified_time=1539612038
bis_parallel=8
buf_size=40
Nthreads=2
nucleotide=false
intermediate_files=false
run_pair_bismark=false
deduplicate=-p
methextractor=-p
del_inter_file=true
single_cell=false
directional=

[STATUS]
quickrun=0
st_prep=0
st_trim=0
st_fastq=0
st_bismark=2
st_bissort=0
st_coreport=0
st_fastqbam=2
st_bisdedup=0
st_dedsort=0
st_bismeth=0
st_cx=0
st_methimpute=0
st_dmrcaller=0
st_bigwig=0
st_bedgraph=0
st_methykit=0

[Methimpute]
intermediate=true
intermediate_mode=constrained
fit_output=true
enrichment_plot=true
full_report=true
context_report=All
mincov=1

[DMR]
file=0
NCORES=4

[CONFIGPART]
resultdir=true
genomref=true

[EMAIL]
email_sen=methylstar@johannes.org
email_rec=
password=
active=

[Others]
tmp_rdata=$result_pipeline/rdata
tmp_fq=$result_pipeline/trimmomatic-files
tmp_log=$result_pipeline/trimmomatic-logs
tmp_qcfast=$result_pipeline/qc-fastq-reports
tmp_bismap=$result_pipeline/bismark-mappers
tmp_covseq=$result_pipeline/cov-seq-reports
tmp_qcbam=$result_pipeline/qc-bam-reports
tmp_dide=$result_pipeline/bismark-deduplicate
tmp_dme=$result_pipeline/bismark-meth-extractor
tmp_clog=$result_pipeline/logs
tmp_cx_report=$result_pipeline/cx-reports
tmp_meth_out=$result_pipeline/methimpute-out
tmp_tes_out=$result_pipeline/tes-reports
tmp_gen_out=$result_pipeline/gene-reports
tmp_fit_out=$result_pipeline/fit-reports
tmp_methyl_fmt=$result_pipeline/methylkit-format
tmp_dmr=$result_pipeline/dmrcaller-format
tmp_bed=$result_pipeline/bedgraph-format
tmp_bigwig=$result_pipeline/bigwig-format

Looking forward to working with you, thank you in advance.

El-Castor commented 4 years ago

I see in the log file that the issue start when bowtie try to do the pair-end mapping due to syntaxe error.

First section of the log file that show an issue:

Now starting a Bowtie 2 paired-end alignment for CTread1GAread2CTgenome (reading in sequences from Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1_G_to_A.fastq, with the options: -q -N 1 -L 32 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --norc))
sh: 1: Syntax error: "(" unexpected
Found no alignment, assigning undef to last_seq_id and last_lines
Now starting a Bowtie 2 paired-end alignment for CTread1GAread2GAgenome (reading in sequences from Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.1_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.1_G_to_A.fastq, with the options: -q -N 1 -L 32 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500 --nofw))
Input files are Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz.temp.2_C_to_T.fastq and Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz.temp.2_G_to_A.fastq (FastQ)
Now running 2 instances of Bowtie 2 against the bisulfite genome of /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/DATA/OMICS/Melon/DNAseq/AdnaneB/Genome_PacBio/toulouse_assemblage/CMiso1.1/20180606/ with the specified options: -q -N 1 -L 32 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500
El-Castor commented 4 years ago

Hi,

I have found the issue. In fat I'm working on cluster build in windows base server, so it construct path with "()" as you can see in this part of the log bismark mapper file : 

Input files to be analysed (in current folder '/ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers'):
/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_1.fq.gz
/K/FLOCAD/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/trimmomatic-files/Mock_FDLM202341331-1a_H3V2NDSXY_L4_paired_2.fq.gz
Library is assumed to be strand-specific (directional), alignments to strands complementary to the original top or bottom strands will be ignored (i.e. not performed!)
Output will be written into the directory: /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/
Summary of all aligner options: -q -N 0 -L 20 --score-min L,0,-0.2 -p 2 --reorder --ignore-quals --no-mixed --no-discordant --dovetail --maxins 500
Running Bismark Parallel version. Number of parallel instances to be spawned: 2

this path more precisly: Output will be written into the directory: /ips2/IPS2 (7864)/DDEVE (8095)/FLOCAD (8099)/Bioinfo/Workspace/ClementP/DavidL/bisulfite-seq/pipe_building/methylstar/Zebularine_treatment_out/bismark-mappers/

I have try the same version of bismark independantly of your pipeline and I have the same issue.

I think, in the bismark code the author take the path to "bismark-mappers" with an ls or something like that right? Do you know how I can custom this part of your code to bypass this issue ? For me we have just to put the path variable in quote to protect the path.

Thanks in advance

shahryary commented 4 years ago

Hi @El-Castor

Thank you for the comments.

This pipeline and most of the tools (ex: samtools, bowtie2, bisamrk) build based on the Linux system, and I highly recommend to use *NIX based systems to run the Pipeline. Another option, you can use our Docker image; if you have already Docker system in your windows-based machine, easily you can deploy the MethylStar docker image and run the pipeline (in this case you don't need to install any software).

El-Castor commented 4 years ago

Hi @shahryary,

Yes you right, but the problem is that I use a cluster and this was choosed by the network admistrator and he doesn't listen anything, he wan to continue with this system assembly ... I have resolve the problem, now I can used your pipeline.

I have another question, can I launch your pipenline in a node cluster. I mean with no interactive session. Because I have lot of sample in different condition and I want to launch it on cluster using sbatch methods. It's possible ?

shahryary commented 4 years ago

Hi @El-Castor,

We are still working on it. The final goal is to run in none-interactive mode with just one configuration file.