search

jodyphelan / TBProfiler

Profiling tool for Mycobacterium tuberculosis to detect ressistance and strain type from WGS data
GNU General Public License v3.0
102 stars 42 forks source link

Exception: Don't know how to handle this mutation #307

Closed schorlton closed 1 month ago

schorlton commented 8 months ago

Thanks for the great tool. This looks similar to https://github.com/jodyphelan/TBProfiler/issues/258 but on official latest (1656b7fe64c5543d55cf52b55de67b2344e9564f) tbdb. It may just be that you haven't had a chance to update tb-profiler yet (apologies).

To recreate: tb-profiler 5.0.0 installed in micromamba docker image

tb-profiler update_tbdb --commit 1656b7fe64c5543d55cf52b55de67b234
4e9564f

Error:

Exception: Don't know how to handle this                    
                    mutation: gyrA                                              
                    c.2517_*25delATCAGGCTCGCCCGACGACGATGCGG
jodyphelan commented 8 months ago

Oh sorry I jumped the gun a bit on updating this before I updated tb-profiler! You can use this, which is the last compatible version:

tb-profiler update_tbdb --commit 0599ccd
schorlton commented 1 month ago

Closing as I assume this is fixed in the latest version. Thanks again!