search

jodyphelan / TBProfiler

Profiling tool for Mycobacterium tuberculosis to detect ressistance and strain type from WGS data
GNU General Public License v3.0
104 stars 43 forks source link

Rifampin resistance rpoB_p.Pro454Ser #368

Open bajwamoneeb opened 4 months ago

bajwamoneeb commented 4 months ago

Hi Jody,

We were sequencing CDC's MPEP samples using their varpipe TB pipeline and for one of the samples their pipeline did not pick up Rifampin resistance of rpoB_p.Pro454Ser; CDC confirmed that they did not expect this mutation for that particular sample (or don't consider it a drug resistance conferring mutation? Still waiting to hear back from them..). Your TB-Profiler however did show this mutation. Any insight?

jodyphelan commented 3 months ago

Hi @bajwamoneeb

Can you let me know which version of the software and database you are using?

bajwamoneeb commented 3 months ago

Hi Jody I used the version 5.0.1 TB Profiler and the default database that version uses. CDC responded and their response was the following:

MPEP 2023-J does contain the variant rpoB_p.Pro454Ser. As you have probably noted in the MPEP report, this sample was not reported as rif resistant by any phenotypic testing method.

Variants known to be associated with rif resistance have been identified in the RRDR (codons 426 – 452) and at codons 170 and 491. The CDC pipeline Varpipe 1.0.2 reports and provides an interpretation for rpoB variants in these regions only.

rpoB_p.Pro454Ser is listed in the WHO catalogue as having an unknown association with rif resistance (limited data, no solo observances). I am not familiar enough with TBProfiler to comment on the underlying evidence used to support their interpretation of this variant. I think that you might need to reach out to TB Profiler for clarification.

jodyphelan commented 3 months ago

Thanks, would you be able to try the latest version on conda (v6.2.1) to see if that fixes the issue? I think that mutation was removed between versions.

bajwamoneeb commented 3 months ago

The mutation still came up. CMPEPJ2_HM_RE.results.json

bajwamoneeb commented 3 months ago

<html xmlns:v="urn:schemas-microsoft-com:vml" xmlns:o="urn:schemas-microsoft-com:office:office" xmlns:x="urn:schemas-microsoft-com:office:excel" xmlns="http://www.w3.org/TR/REC-html40">

sample | main_lineage | sub_lineage | spoligotype | drtype | target_median_depth | pct_reads_mapped | num_reads_mapped | num_dr_variants | num_other_variants | rifampicin | isoniazid | ethambutol | pyrazinamide | moxifloxacin | levofloxacin | bedaquiline | delamanid | pretomanid | linezolid | streptomycin | amikacin | kanamycin | capreomycin | clofazimine | ethionamide | para-aminosalicylic_acid | cycloserine -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- | -- CMPEPJ2_HM_RE | lineage4 | lineage4.3.4.2.1 | - | RR-TB | 67 | 99.58 | 1400511 | 3 | 24 | rpoB p.Pro454Ser (1.00) | - | - | - | - | - | - | fbiC c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT (0.48), fbiC c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT (1.00) | fbiC c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT (0.48), fbiC c.2565_*55delGGCCTAGCCCCGGCGACGATGCCGGGTCGCGGGATGCGGCCCGTTGAGGAGCGGGGCAATCT (1.00) | - | - | - | - | - | - | - | - | -

jodyphelan commented 3 months ago

It seem the mutation is still in the default database (tbdb) but not in the strict WHO database (who). It looks like this mutation has very little evidence and should most likely be removed from the databse. I'll get that process started now.

jodyphelan commented 3 months ago

Also I see that you have a variant in fbiC. I believe this to be a true variant which should actually be at 100%, however as explained here, I don't think this should lead to the exact same protien sequence and therefor would not confer resistance.