Error! Experimental sample has no analyzable fragments

[ofirgriess]

Hey! I'm attempting to peak call single end ChIP-seq data. This is the command (I made sure to use the -y option)

Genrich -t h3_mapq20_sorted.bam -o h3 -c mock_mapq20_sorted.bam -y

I get the error mentioned in title

Please help me :(

[ofirgriess]

This is what the -v option shows

[jsh58]

Thanks for including the verbose output. Can you please post the first few lines of the BAM file:

samtools view h3_mapq20_sorted.bam | head -n4

[ofirgriess]

Thank you for your reply! Here it is

[jsh58]

please post the text, not an image

[ofirgriess]

SRR747789.85    16      Chr04   21807617        255     48M     *       0      0TGAATTGCTAATTGAGAATATACTGGGTATCTAGCTGTAGAGAGTGTA        B]X^BA`^`BB`Z<2O]acca@;Z@Aabc^]b]]aaccbWWb^^[[cc        XA:i:2  MD:Z:48 NM:i:0  CM:i:6  XM:i:2
SRR747789.90    0       Chr11   6859721 255     48M     *       0       0      GCTTATAAGTAATCAATTTATCCTTATCTTTTGTCTCATTTATTTTTT aaccb``b``_^bcb`abbc[ZA>_B=]b`\]]>?YW=Aa_`B@`^]@        XA:i:2  MD:Z:48 NM:i:0  CM:i:6  XM:i:2
SRR747789.94    16      Chr09   16746712        255     48M     *       0      0AATTTGAATGGGACGAAGGTTTACACTGGCGCTGGTGGTGCAATACTT        B^TV?>\^_@>W[B4UbbcRRBBcB@_`bc_[_c_^_`babcccccbb        XA:i:2  MD:Z:48 NM:i:0  CM:i:6  XM:i:2
SRR747789.96    0       Chr01   3232332 255     48M     *       0       0      AGTAAAAATTCGCTTACTGCCAAAATGGACAAATTTGAAAGATAAAGG ]Y[VSTQUQTWSRGKWYVNJOA(-K?0FI8=HM=2A8));;806G;&!        XA:i:2  MD:Z:48 NM:i:0  CM:i:7  XM:i:2

[jsh58]

Even with just those 4 reads, it works for me:

$ Genrich -t sample.bam -o /dev/null -yv
Processing experimental file #0: sample.bam
  BAM records analyzed:           4
    Paired alignments:            0
    Unpaired alignments:          4
  Fragments analyzed:             4
    Full fragments:               0
    Half fragments:               4
      (from unpaired alns)
- control file #0 not provided -
  Background pileup value: 0.000000
Peak-calling parameters:
  Genome length: 3095693981bp
  Significance threshold: -log(p) > 2.000
  Min. AUC: 200.000
  Max. gap between sites: 100bp
Peaks identified: 4 (192bp)

[ofirgriess]

Strange... I'm working on ubuntu 18.4, do you think it has something to do with it? Thanks again for all your help!

[ofirgriess]

Would you kindly explain how you saved the text I've sent you? I want to try what you did again