search

junchaoshi / sports1.1

Small non-coding RNA annotation Pipeline Optimized for rRNA- and tRNA-Derived Small RNAs
GNU General Public License v3.0
45 stars 16 forks source link

No output #18

Closed whecrane closed 3 years ago

whecrane commented 3 years ago

Dear sir, When I used the sports1.1, there is no error but I don't know have no output. Please give me some advice, thank you very much.

Best wishes, Crane

$./source/sports.pl -i Sperm.txt -p 4 -a -x GTTCAGAGTTCTACAGTCCGACGATC -y TGGAATTCTCGGGTGCCAAGG -g ./Mus_musculus/genome/mm10/genome -m ./Mus_musculus/miRBase/21/miRBase_21-mmu -r ./Mus_musculus/rRNAdb/mouse_rRNA -t ./Mus_musculus/GtRNAdb/mm10/mm10-tRNAs -w ./Mus_musculus/piRBase/piR_mouse -e ./Mus_musculus/Ensembl/release-89/Mus_musculus.GRCm38.ncrna -f ./Mus_musculus/Rfam/12.3/Rfam-12.3-mouse -o ../Reads/output -k

SPORTS version: 1.1.1

Citation: Junchao Shi, Eun-A Ko, Kenton M. Sanders, Qi Chen, Tong Zhou. “SPORTS1.0: a tool for annotating and profiling non-coding RNAs optimized for rRNA-and tRNA-derived small RNAs.” Genomics, Proteomics & Bioinformatics (2018) doi.org/10.1016/j.gpb.2018.04.004.

Input file address: /media/EXTend2018/Wanghe2019/zahuo/tsRNA/sports1.1-master/Sperm.txt output file address: ../Reads/output Reference genome address: ./Mus_musculus/genome/mm10/genome Reference miRNA database address: ./Mus_musculus/miRBase/21/miRBase_21-mmu Reference tRNA database address: ./Mus_musculus/GtRNAdb/mm10/mm10-tRNAs Reference rRNA database address: ./Mus_musculus/rRNAdb/mouse_rRNA Reference piRNA database address: ./Mus_musculus/piRBase/piR_mouse Reference ensembl ncRNA database address: ./Mus_musculus/Ensembl/release-89/Mus_musculus.GRCm38.ncrna Reference rfam ncRNA database address: ./Mus_musculus/Rfam/12.3/Rfam-12.3-mouse Trimming 5' adapter: GTTCAGAGTTCTACAGTCCGACGATC Trimming 3' adapter: TGGAATTCTCGGGTGCCAAGG Filtering min lenth: 15 Filtering max lenth: 45 Mapping mismatch tolerance: 0 Debugging mode ON: keep all the intermediate files generated during the running progress Use of uninitialized value $tmp in -d at ./source/sports.pl line 352, line 1. Use of uninitialized value $tmp in -f at ./source/sports.pl line 387, line 1. Use of uninitialized value $tmp in -d at ./source/sports.pl line 352, line 2. Use of uninitialized value $tmp in -f at ./source/sports.pl line 387, line 2. Use of uninitialized value $tmp in -d at ./source/sports.pl line 352, line 3. Use of uninitialized value $tmp in -f at ./source/sports.pl line 387, line 3. Use of uninitialized value $tmp in -d at ./source/sports.pl line 352, line 4. Use of uninitialized value $tmp in -f at ./source/sports.pl line 387, line 4. Use of uninitialized value $tmp in -d at ./source/sports.pl line 352, line 5. Use of uninitialized value $tmp in -f at ./source/sports.pl line 387, line 5. Use of uninitialized value $tmp in -d at ./source/sports.pl line 352, line 6. Use of uninitialized value $tmp in -f at ./source/sports.pl line 387, line 6.

Processing input files...

Done!

junchaoshi commented 3 years ago

Hi Crane,

Could you upload the header of your input file?