search

junchaoshi / sports1.1

Small non-coding RNA annotation Pipeline Optimized for rRNA- and tRNA-Derived Small RNAs
GNU General Public License v3.0
45 stars 16 forks source link

how to add MT-tRNA sequence into GtRNAdb #7

Closed sunhaifeng123 closed 4 years ago

sunhaifeng123 commented 4 years ago

Hi: Thanks very much for your work, Sports1.0 is very nice and useful. My species genome is mm10, and I think some tsRNAs are derived from tRNA. But when I add the MT-tRNA sequence into mm10-tRNAs.fa like this:

Mus_musculus_tRNA-MTSer-TGA-1-1 GAGAAAGACATATAGGATATGAGATTGGCTTGAAACCAATTTTAGGGGGTTCGATTCCTTCCTTTCTTA Mus_musculus_tRNA-MTThr-TGT-1-1 GTCTTGATAGTATAAACATTACTCTGGTCTTGTAAACCTGAAATGAAGATCTTCTCTTCTCAAGACA

and then run sports.pl. The result is like:

t00000651 TCCCTGGTGGTCTAGTGGTTAGGATTCGGC 30 2 Yes tRNA-Glu-CTC_5_end;tRNA--_5_end t00000769 AAGAAAGATTGCAAGAACTG 20 2 Yes tRNA--_5_end t00001268 GCATTGGTGGTTCAGTGGTAGAATTCTCGCCT 32 2 Yes tRNA-Gly-GCC_5_end;tRNA-Gly-CCC_5_end

which is not my expectation. I dont know how to solve this problem. Can you give me some advices?

Thank you in andvance for any help! Best wishes

Haifeng Sun 2020.01.10

junchaoshi commented 4 years ago

Hi Haifeng,

The tRNA annotation should follow the GtRNAdb naming system, such as:

>Mus_musculus_tRNA-Ala-AGC-1-1 (tRNAscan-SE ID: chr13.trna91) Ala (AGC) 72 bp Sc: 85.3 chr13:21242570-21242641 (+)

The shortest version should be: >Mus_musculus_tRNA-Ala-AGC-1-1 Ala (AGC) 72 bp

And a new version of SPORTS will release soon which will have a better annotation on tRNA. :)

My best, Junchao

sunhaifeng123 commented 4 years ago

Dear Junchao, Thank you very much! and looking forward to a better SPORTS! Best wishes Haifeng

junchaoshi commented 4 years ago

Hi Haifeng, mt_tRNA database for mouse and human have updated and more species will update soon! Please update the software and the annotation databases as well.

My best, Junchao