search

ldenti / klocate

0 stars 0 forks source link

Bus error #1

Closed chklopp closed 2 years ago

chklopp commented 2 years ago

Hi,

I've indexed the example data using klocate index dros.4.fa then aligned with klocate find dros.4.fa query.k23.fa and I got : [M::bwa_idx_load_from_disk] read 0 ALT contigs Index load. Erreur du bus after 2696320 lines

Another test, I've extracted one sequence from the reference dros.4.fa

0 TTTTAATTTACTTAACATAGG If I search this sequence with grep I find it once (kind of proxy to the real count because de reference fasta is multi-line) and the resulting output file contains 2696320 lines which is quite impossible.

ldenti commented 2 years ago

Hi, can you please run:

./klocate find -f 1 dros.4.fa query.k23.fa

(note the -f 1 argument to specify the query file format).

By default, the query file is expected to be a txt file (i.e., one kmer per line). Using -f 1, the query file is expected to be in fasta/q.

Let me know, Luca

chklopp commented 2 years ago

Thank you. I thought that the default file format was fasta. It works now.

ldenti commented 2 years ago

Great!