Miss-called sequence

[mel9320107]

I'm running DiMSum with the flags below and wild-type sequence is called as

MGLLLLRWQFARLRHLW instead of LGLLLLRWQFARLRHLW

I haven't noticed any problems in other jobs I've run, so I'm at a bit of a loss.

DiMSum \ --projectName=Tpo_L2_QC \ --experimentDesignPath=TpoR_levels_QC.txt \ --outputPath=TpoR_levels \ --retainIntermediateFiles=T \ --startStage=1 \ --wildtypeSequence=CTGGGCCTGCTGCTGCTGAGGTGGCAGTTTGCAAGACTGAGGCATCTGTGG \ --fastqFileDir=fastq \ --paired=F \ --mutagenesisType=codon \ --maxSubstitutions=2 \ --numCores=4 \ --fitnessMinInputCountAll=1 \ --experimentDesignPairDuplicates=T

First few lines of fitness_silent.txt

Pos WT_AA Mut nt_seq aa_seq Nham_nt Nham_aa Nmut_codons STOP STOP_readthrough mean_count fitness sigma NA NA NA atgggcctgctgctgctgaggtggcagtttgcaagactgaggcatctgtgg MGLLLLRWQFARLRHLW 1 0 1 FALSE FALSE 17 -0.143357736045247 0.20071427837144 NA NA NA atgggcctgcttctgctgaggtggcagtttgcaagactgaggcatctgtgg MGLLLLRWQFARLRHLW 2 0 2 FALSE FALSE 1 -1.30147925395778 2.09851478161762 NA NA NA ctgggactgctgctgctgaggtggcagtttgcaagactgaggcatctgtgg MGLLLLRWQFARLRHLW 1 0 1 FALSE FALSE 25 -0.274872356214975 0.170651728595039 NA NA NA ctgggcctactgctgctgaggtggcagtttgcaagactgaggcatctgtgg MGLLLLRWQFARLRHLW 1 0 1 FALSE FALSE 24 0.493995640850833 0.147880669389096 NA NA NA ctgggcctcctgctgctgaggtggcagtttgcaagactgaggcatctgtgg MGLLLLRWQFARLRHLW 1 0 1 FALSE FALSE 19 -0.91009800482737 0.255980048411722

[andrefaure]

Hi @mel9320107

This was a bug in versions <1.2.9, see release notes: https://github.com/lehner-lab/DiMSum/releases/tag/v1.2.9

Please update DiMSum to the latest version:

conda activate dimsum
conda install -c bioconda r-dimsum=1.2.11

[mel9320107]

Thanks for the quick response! It's working as expected now.