Closed oschwengers closed 6 years ago
Hi, thanks for the great tool! I use it regularly and have incorporated it into many pipelines and workflows.
What do you thinks about a new seqtk seq option in order to wrap multi line fasta files into single line files?
seqtk seq
Example:
>foo atcgactgatg ctagtcatgctg gat >bar tagctacgttac gattcga
would become:
>foo atcgactgatgctagtcatgctggat >bar tagctacgttacgattcga
I do this very often to preprocess and filter huge fasta files. I guess this would be a nice feature for many people and implementing it shouldn't be a tough task... Thanks a lot!
You need to update seqtk. seqtk seq outputs single line from at least 2 years ago.
seqtk
Hello @shenwei356 , my fault.... thanks for the advice!
Hi, thanks for the great tool! I use it regularly and have incorporated it into many pipelines and workflows.
What do you thinks about a new
seqtk seq
option in order to wrap multi line fasta files into single line files?Example:
would become:
I do this very often to preprocess and filter huge fasta files. I guess this would be a nice feature for many people and implementing it shouldn't be a tough task... Thanks a lot!