search

lh3 / seqtk

Toolkit for processing sequences in FASTA/Q formats
MIT License
1.35k stars 311 forks source link

seq -A identifies ">" in FASTQ as FASTA header #124

Closed ZeweiSong closed 5 years ago

ZeweiSong commented 5 years ago

It seems that the ">" character in the Q-score is mis-identified as the FASTA header when using the seq -A option:

>V300010089L2C001R004734960/2
ATGCGAGAACCAAGAGATCCGTTG
>:EFFFE>FFFFFFFFFGBFFFFFFFE;F@>+FF

>V300010089L2C001R004749445/2
ATGCGAGAACCAAGAG
lh3 commented 5 years ago

But yours is not a fastq.

ZeweiSong commented 5 years ago

This is the FASTA output of "seq -A"

lh3 commented 5 years ago

What matters is your FASTQ input.

ZeweiSong commented 5 years ago

Got it! My output from fastp has misplaced lines (for some reason).