search

liulab-dfci / TRUST4

TCR and BCR assembly from RNA-seq data
MIT License
269 stars 46 forks source link

IndexError: list index out of range #293

Open origami974 opened 1 month ago

origami974 commented 1 month ago

Dear Dr. Li, I have encountered some problems while studying TRUST4 script commands recently. I hope to receive your guidance: About barcoderep-filter. py, the first two lines of the report. out in my TRUST4 output file are as follows

count frequency CDR3nt CDR3aa V D J C cid cid_full_length

1343 7.73E-02 TGTGCCTGTGACGCTTTACTGGGGGATACGCCTCCGTCGGGCGATAAACTCATCTTT CACDALLGDTPPSGDKLIF TRDV201 TRDD301 TRDJ101 TRDC assemble7 0 926 5.33E-02 TGTGCCTGTGACCCCCTGGGGCCGTACACCGATAAACTCATCTTT CACDPLGPYTDKLIF TRDV201 TRDD301 TRDJ101 TRDC assemble9 0 The command to run is: python barcoderep-filter. py - b TRUST_SRR28216602_report. tsv > fliter_SRR282116602_report.xls, The program has no errors,but it seems that no clones have been filtered. Then I tried using - a TRUST_SRR28216602-annot.fa -- highAbund and -- diffuseFrac and set thresholds, and the result was still the same

2 encountered an error in barcoderep-expend.py: Traceback (most recent call last): File "/data/zhanqh/TRUST4/scripts/barcoderep-expand.py", line 76, in primaryAbund = float(cols[1 + chain].split(',')[6]) IndexError: list index out of range Command: python barcoderep-expand.py -b TRUST_SRR28216602_report. tsv -- chain 1-- frac 0.1>/data/data_all/SRR_data/SRR28216602/expend_SRR28216602_report. xls Thank you in advance for your reply.

mourisl commented 1 month ago

The barcoderep-xxx command is for the barcode report file. Your input for the script is the bulk report file.

origami974 commented 1 month ago

That means my raw data is actually not scRNAseq data but bulk, so my report.out file is not suitable for the barcoderep command?

mourisl commented 1 month ago

What was your running command? And you should know whether your data is scRNAseq or bulk, which is critical in how to run TRUST4.

origami974 commented 1 month ago

I can distinguish my data type, but I am confused now. My data comes from the raw data of SRA. After fast-dump processing, I obtained a fastq file and imported it into TRUST4(run-trust4 -f hg38_bcrtcr.fa --ref human_IMGT+C.fa -u SRRxxx.fq > xxx). However, there is no barcode report file in the result. Is there a problem with my running mode? And I noticed in the README that only the output file of 10X genomics data contains a barcode report file, so I would like to know if single-cell data from other platforms can also be exported as barcode report files?I'm sorry for the inconvenience I've caused you

mourisl commented 1 month ago

You need options like "--barcode" and "--readFormat" to specify the barcode sequence file and the range. Your running command is for bulk data set.