Open origami974 opened 1 month ago
The barcoderep-xxx command is for the barcode report file. Your input for the script is the bulk report file.
That means my raw data is actually not scRNAseq data but bulk, so my report.out file is not suitable for the barcoderep command?
What was your running command? And you should know whether your data is scRNAseq or bulk, which is critical in how to run TRUST4.
I can distinguish my data type, but I am confused now. My data comes from the raw data of SRA. After fast-dump processing, I obtained a fastq file and imported it into TRUST4(run-trust4 -f hg38_bcrtcr.fa --ref human_IMGT+C.fa -u SRRxxx.fq > xxx). However, there is no barcode report file in the result. Is there a problem with my running mode? And I noticed in the README that only the output file of 10X genomics data contains a barcode report file, so I would like to know if single-cell data from other platforms can also be exported as barcode report files?I'm sorry for the inconvenience I've caused you
You need options like "--barcode" and "--readFormat" to specify the barcode sequence file and the range. Your running command is for bulk data set.
Dear Dr. Li, I have encountered some problems while studying TRUST4 script commands recently. I hope to receive your guidance: About barcoderep-filter. py, the first two lines of the report. out in my TRUST4 output file are as follows
count frequency CDR3nt CDR3aa V D J C cid cid_full_length
1343 7.73E-02 TGTGCCTGTGACGCTTTACTGGGGGATACGCCTCCGTCGGGCGATAAACTCATCTTT CACDALLGDTPPSGDKLIF TRDV201 TRDD301 TRDJ101 TRDC assemble7 0 926 5.33E-02 TGTGCCTGTGACCCCCTGGGGCCGTACACCGATAAACTCATCTTT CACDPLGPYTDKLIF TRDV201 TRDD301 TRDJ101 TRDC assemble9 0 The command to run is: python barcoderep-filter. py - b TRUST_SRR28216602_report. tsv > fliter_SRR282116602_report.xls, The program has no errors,but it seems that no clones have been filtered. Then I tried using - a TRUST_SRR28216602-annot.fa -- highAbund and -- diffuseFrac and set thresholds, and the result was still the same
2 encountered an error in barcoderep-expend.py: Traceback (most recent call last): File "/data/zhanqh/TRUST4/scripts/barcoderep-expand.py", line 76, in
primaryAbund = float(cols[1 + chain].split(',')[6])
IndexError: list index out of range
Command: python barcoderep-expand.py -b TRUST_SRR28216602_report. tsv -- chain 1-- frac 0.1>/data/data_all/SRR_data/SRR28216602/expend_SRR28216602_report. xls
Thank you in advance for your reply.