search

lmdu / pyfastx

a python package for fast random access to sequences from plain and gzipped FASTA/Q files
https://pyfastx.readthedocs.io
MIT License
250 stars 20 forks source link

read.seq end with read.name when using pyfastx.Fastq in parsing long read FASTQ file #78

Open QYanwei opened 5 months ago

QYanwei commented 5 months ago

Hi, I found an error when I use pyfastx.Fastq to parsing the long read FASTQ file. The read.name untimely appearance in the end of read.seq string, such as 'GGCATTTTTCCGTTTGTCACTTCTTCTTCGCTATCCTGTT@390872df-5709-4012-8278-1f4969a328af ch=103 start_time=2021-01-21T19:40:20.617'. The pyfastx version is 2.0.2. Can you check what this issue is?

code: fq = pyfastx.Fastq('../test/ecoli.fq.gz') for read in fq: if '@' in read.seq: print(read.name) print(read.seq) print(read.qual)

QYanwei commented 5 months ago

read name error in read seq end

aStudyingTurtle commented 4 months ago

I have the same problem.

lmdu commented 4 months ago

Thanks, I will check this issue.

lmdu commented 4 months ago

I have fixed it in v2.1.0.