search

lucapinello / CRISPResso

Software pipeline for the analysis of CRISPR-Cas9 genome editing outcomes from sequencing data
Other
131 stars 55 forks source link

Python error running locally #18

Closed danielnavarrogomez closed 7 years ago

danielnavarrogomez commented 7 years ago

Hello,

I tried your software online and it worked perfect for my sample, so I installed it on my system using pip (as recommended), but when I run the same sample with exactly the same options that you do on the website (commandline extracted from the report that your webtool generates), it gives me an error:

[...]
INFO  @ Tue, 25 Apr 2017 22:09:46:
         Quantifying indels/substitutions...

/modules/ogi-mbc/software/CRISPResso/0.7.0/lib/python2.7/site-packages/CRISPResso/CRISPRessoCORE.py:1336: RuntimeWarning: invalid value encountered in divide
  avg_vector_ins_all/=(effect_vector_insertion+effect_vector_insertion_hdr+effect_vector_insertion_mixed)
/modules/ogi-mbc/software/CRISPResso/0.7.0/lib/python2.7/site-packages/CRISPResso/CRISPRessoCORE.py:1337: RuntimeWarning: invalid value encountered in divide
  avg_vector_del_all/=(effect_vector_deletion+effect_vector_deletion_hdr+effect_vector_deletion_mixed)
INFO  @ Tue, 25 Apr 2017 22:18:12:
         Done!

INFO  @ Tue, 25 Apr 2017 22:18:12:
         Calculating indel distribution based on the length of the reads...

INFO  @ Tue, 25 Apr 2017 22:18:21:
         Done!

INFO  @ Tue, 25 Apr 2017 22:18:21:
         Calculating alleles frequencies...

CRITICAL @ Tue, 25 Apr 2017 22:18:21:
         Unexpected error, please check your input.

ERROR: invalid literal for int() with base 10: '0rc1'

Commandline:

CRISPResso -a CGAGAGCCGCAGCCATGAACGGCACAGAGGGCCCCAATTTTTATGTGCCCTTCTCCAACGTCACAGGCGTGGTGCGGAGCCCCTTCGAGCAGCCGCAGTACTACCTGGCGGAACCATGGCAGTTCTCCATGCTGGCAGCGTACATGTTCCTGCTCATCGTGCTGGG -r1 ../spli
t_fastq/2.P23H2_Het_276035w_DB12.fastq.R1.fastq -r2 ../split_fastq/2.P23H2_Het_276035w_DB12.fastq.R2.fastq -q 0 -s 0 --exclude_bp_from_left 15 --exclude_bp_from_right 15 --hdr_perfect_alignment_threshold 98 -w 1 --name TMP --output_folder
 ./ --save_also_png

I understand that must be something regarding my installation, but I have no clue what is not going well.

Thanks.

lucapinello commented 7 years ago

Hi Daniel,

Thanks for the report.

Some quick questions:

1) Operating System ? 2) Are you using Anaconda Python 2.7? 3) Do you have the same problem using the docker version?

danielnavarrogomez commented 7 years ago

Sorry that is taking me long to answer, but I'll answer your questions as soon as I have a chance.