search

lucapinello / CRISPResso

Software pipeline for the analysis of CRISPR-Cas9 genome editing outcomes from sequencing data
Other
131 stars 55 forks source link

Unexpected error: invalid literal for int() with base 10: '0rc1' #33

Closed strohmjeff closed 6 years ago

strohmjeff commented 6 years ago

JC04-4-CT13_short.txt

JC04-4-CT13_S4_filter.fastq.gz

Hi there,

I ran the web version and these files generated meaningful output, but when running the following with the command line version, I get the following error:

earnest@biolinux8[CRISPResso-master] python CRISPResso.py -r1 /home/earnest/Jeff.S/CRISPR_test/merged/filter/JC04-4-CT13_S4_filter.fastq -a TGCATGTCATCTCTTTCAGGTGTGGCATTTCAAGGGGGCTTGTGTCTTGAAAACAGCAACTGTGAGGACACTTGATAGTCATTTCCTTCAGTTCTGCTTTTGTCTCCCTAGGTGACTGTGGCCTTCCCCCAGATGTACCTAATGCCCAGCCAGCTTTGGAAGGCCGTACAAGTTTTCCCGAGGATACTGTAATAACGTACAAATGTGAAGAAAGCTTTGTGAAAATTCCTGGCGAGAAGGACTCAGT


-Analysis of CRISPR/Cas9 outcomes from deep sequencing data-

                      )
                     (
                    __)__
                 C\|     |
                   \     /
                    \___/

[Luca Pinello 2015, send bugs, suggestions or *green coffee* to lucapinello AT gmail DOT com]

Version 1.0.8

WARNING @ Tue, 14 Nov 2017 16:39:12:
     Folder CRISPResso_on_JC04-4-CT13_S4_filter already exists. 

INFO  @ Tue, 14 Nov 2017 16:39:12:
     Preparing files for the alignment... 

INFO  @ Tue, 14 Nov 2017 16:39:12:
     Done! 

INFO  @ Tue, 14 Nov 2017 16:39:12:
     Aligning sequences... 

INFO  @ Tue, 14 Nov 2017 16:40:01:
     Align sequences to reverse complement of the amplicon... 

INFO  @ Tue, 14 Nov 2017 16:40:01:
     Done! 

INFO  @ Tue, 14 Nov 2017 16:40:23:
     Quantifying indels/substitutions... 

INFO  @ Tue, 14 Nov 2017 16:43:49:
     Done! 

INFO  @ Tue, 14 Nov 2017 16:43:49:
     Calculating indel distribution based on the length of the reads... 

INFO  @ Tue, 14 Nov 2017 16:43:51:
     Done! 

INFO  @ Tue, 14 Nov 2017 16:43:51:
     Calculating alleles frequencies... 

CRITICAL @ Tue, 14 Nov 2017 16:43:51:
     Unexpected error, please check your input.

ERROR: invalid literal for int() with base 10: '0rc1'
lucapinello commented 6 years ago

This may be related to your local version of Python and the libraries you have installed. Some things to check: 1) Operating System ? 2) Are you using Anaconda Python 2.7? 3) Do you have the same problem using the docker version?

strohmjeff commented 6 years ago

Thanks, it's Ubuntu v14, I suspected that may be the case, and set it to upgrade to 16 overnight.

I'm calling python 3 by default. I'll follow up with these and let you know if I can't resolve it.

On Nov 14, 2017 8:13 PM, "Luca Pinello" notifications@github.com wrote:

This may be related to your local version of Python and the libraries you have installed. Some things to check:

  1. Operating System ?
  2. Are you using Anaconda Python 2.7?
  3. Do you have the same problem using the docker version?

— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub https://github.com/lucapinello/CRISPResso/issues/33#issuecomment-344480810, or mute the thread https://github.com/notifications/unsubscribe-auth/AfiTjiMTWQwtBELyyX6Fs6ysLk-ttK3lks5s2mT2gaJpZM4QeOg_ .

lucapinello commented 6 years ago

Try to install Anaconda Python 2.7 and please let me know if this fixes your problem. Python 3 is not currently supported.

strohmjeff commented 6 years ago

Hi Luca,

I've installed and activated my anaconda 2.7 environment.

python --version yields "Python 2.7.14 :: Anaconda custom (64-bit)"

when I run CRISPResso.py from within the -master directory with the following command:

python CRISPResso.py -r1 /home/earnest/Jeff.S/CRISPR_test/merged/filter/JC04-4-CT13_S4_filter.fastq -a TGCATGTCATCTCTTTCAGGTGTGGCATTTCAAGGGGGCTTGTGTCTTGAAAACAGCAACTGTGAGGACACTTGATAGTCATTTCCTTCAGTTCTGCTTTTGTCTCCCTAGGTGACTGTGGCCTTCCCCCAGATGTACCTAATGCCCAGCCAGCTTTGGAAGGCCGTACAAGTTTTCCCGAGGATACTGTAATAACGTACAAATGTGAAGAAAGCTTTGTGAAAATTCCTGGCGAGAAGGACTCAGT

I now get:

CRITICAL @ Wed, 15 Nov 2017 12:23:29: You need to install pandas module to use CRISPResso!

However, 'conda list' shows pandas 0.20.3 py27h820b67f_2 installed.

pip install CRISPResso comes back as already satisfied.

However, when I try CRISPResso --help, I get "not defined"

How should I be calling python and CRISPResso?

Thanks for you help!

-Jeff

On Wed, Nov 15, 2017 at 5:23 AM, Luca Pinello notifications@github.com wrote:

Try to install Anaconda Python 2.7 and please let me know if this fixes your problem. Python 3 is not currently supported.

— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub https://github.com/lucapinello/CRISPResso/issues/33#issuecomment-344590686, or mute the thread https://github.com/notifications/unsubscribe-auth/AfiTji_KghjP30xn2G0COk2-zG6mFv0sks5s2uXHgaJpZM4QeOg_ .

lucapinello commented 6 years ago

You should not run CRISPResso from the master directory. From within that directory try to run:

python setup.py install

This should reinstall CRISPResso for Anaconda and will create the script.

If this doesn't work you may want to consider to use the docker image.

strohmjeff commented 6 years ago

OK I tried that a few days ago, but here it is again, if you don't see anything out of place I will try the docker thanks

(py27) earnest@biolinux8[CRISPResso-master] python setup.py install [12:46PM] running install running bdist_egg running egg_info writing requirements to CRISPResso.egg-info/requires.txt writing CRISPResso.egg-info/PKG-INFO writing top-level names to CRISPResso.egg-info/top_level.txt writing dependency_links to CRISPResso.egg-info/dependency_links.txt writing entry points to CRISPResso.egg-info/entry_points.txt reading manifest file 'CRISPResso.egg-info/SOURCES.txt' reading manifest template 'MANIFEST.in' writing manifest file 'CRISPResso.egg-info/SOURCES.txt' installing library code to build/bdist.linux-x86_64/egg running install_lib running build_py creating build/bdist.linux-x86_64/egg creating build/bdist.linux-x86_64/egg/CRISPResso creating build/bdist.linux-x86_64/egg/CRISPResso/data copying build/lib/CRISPResso/data/NexteraPE-PE.fa -> build/bdist.linux-x86_64/egg/CRISPResso/data copying build/lib/CRISPResso/data/.DS_Store -> build/bdist.linux-x86_64/egg/CRISPResso/data copying build/lib/CRISPResso/data/TruSeq3-PE-2.fa -> build/bdist.linux-x86_64/egg/CRISPResso/data copying build/lib/CRISPResso/data/TRIMMOMATIC_LICENSE -> build/bdist.linux-x86_64/egg/CRISPResso/data copying build/lib/CRISPResso/data/TruSeq2-PE.fa -> build/bdist.linux-x86_64/egg/CRISPResso/data copying build/lib/CRISPResso/data/TruSeq3-PE.fa -> build/bdist.linux-x86_64/egg/CRISPResso/data copying build/lib/CRISPResso/data/TruSeq3-SE.fa -> build/bdist.linux-x86_64/egg/CRISPResso/data copying build/lib/CRISPResso/data/trimmomatic-0.33.jar -> build/bdist.linux-x86_64/egg/CRISPResso/data copying build/lib/CRISPResso/data/TruSeq2-SE.fa -> build/bdist.linux-x86_64/egg/CRISPResso/data copying build/lib/CRISPResso/CRISPRessoCountCORE.py -> build/bdist.linux-x86_64/egg/CRISPResso copying build/lib/CRISPResso/.DS_Store -> build/bdist.linux-x86_64/egg/CRISPResso copying build/lib/CRISPResso/CRISPRessoCORE.py -> build/bdist.linux-x86_64/egg/CRISPResso copying build/lib/CRISPResso/init.pyc -> build/bdist.linux-x86_64/egg/CRISPResso copying build/lib/CRISPResso/CRISPRessoWGSCORE.py -> build/bdist.linux-x86_64/egg/CRISPResso copying build/lib/CRISPResso/CRISPRessoPooledCORE.py -> build/bdist.linux-x86_64/egg/CRISPResso copying build/lib/CRISPResso/CRISPRessoCORE.pyc -> build/bdist.linux-x86_64/egg/CRISPResso copying build/lib/CRISPResso/init.py -> build/bdist.linux-x86_64/egg/CRISPResso copying build/lib/CRISPResso/CRISPRessoPooledWGSCompareCORE.py -> build/bdist.linux-x86_64/egg/CRISPResso copying build/lib/CRISPResso/main.py -> build/bdist.linux-x86_64/egg/CRISPResso copying build/lib/CRISPResso/CRISPRessoCompareCORE.py -> build/bdist.linux-x86_64/egg/CRISPResso byte-compiling build/bdist.linux-x86_64/egg/CRISPResso/CRISPRessoCountCORE.py to CRISPRessoCountCORE.pyc byte-compiling build/bdist.linux-x86_64/egg/CRISPResso/CRISPRessoWGSCORE.py to CRISPRessoWGSCORE.pyc byte-compiling build/bdist.linux-x86_64/egg/CRISPResso/CRISPRessoPooledCORE.py to CRISPRessoPooledCORE.pyc byte-compiling build/bdist.linux-x86_64/egg/CRISPResso/CRISPRessoPooledWGSCompareCORE.py to CRISPRessoPooledWGSCompareCORE.pyc byte-compiling build/bdist.linux-x86_64/egg/CRISPResso/main.py to main.pyc byte-compiling build/bdist.linux-x86_64/egg/CRISPResso/CRISPRessoCompareCORE.py to CRISPRessoCompareCORE.pyc creating build/bdist.linux-x86_64/egg/EGG-INFO copying CRISPResso.egg-info/PKG-INFO -> build/bdist.linux-x86_64/egg/EGG-INFO copying CRISPResso.egg-info/SOURCES.txt -> build/bdist.linux-x86_64/egg/EGG-INFO copying CRISPResso.egg-info/dependency_links.txt -> build/bdist.linux-x86_64/egg/EGG-INFO copying CRISPResso.egg-info/entry_points.txt -> build/bdist.linux-x86_64/egg/EGG-INFO copying CRISPResso.egg-info/requires.txt -> build/bdist.linux-x86_64/egg/EGG-INFO copying CRISPResso.egg-info/top_level.txt -> build/bdist.linux-x86_64/egg/EGG-INFO zip_safe flag not set; analyzing archive contents... CRISPResso.CRISPRessoCORE: module references file CRISPResso.CRISPRessoCompareCORE: module references file CRISPResso.CRISPRessoCountCORE: module references file CRISPResso.CRISPRessoPooledCORE: module references file CRISPResso.CRISPRessoPooledWGSCompareCORE: module references file CRISPResso.CRISPRessoWGSCORE: module references file creating 'dist/CRISPResso-1.0.8-py2.7.egg' and adding 'build/bdist.linux-x86_64/egg' to it removing 'build/bdist.linux-x86_64/egg' (and everything under it) Processing CRISPResso-1.0.8-py2.7.egg removing '/home/earnest/anaconda2/envs/py27/lib/python2.7/site-packages/CRISPResso-1.0.8-py2.7.egg' (and everything under it) creating /home/earnest/anaconda2/envs/py27/lib/python2.7/site-packages/CRISPResso-1.0.8-py2.7.egg Extracting CRISPResso-1.0.8-py2.7.egg to /home/earnest/anaconda2/envs/py27/lib/python2.7/site-packages CRISPResso 1.0.8 is already the active version in easy-install.pth Installing CRISPRessoWGS script to /home/earnest/anaconda2/envs/py27/bin Installing CRISPRessoPooledWGSCompare script to /home/earnest/anaconda2/envs/py27/bin Installing CRISPRessoCount script to /home/earnest/anaconda2/envs/py27/bin Installing CRISPRessoCompare script to /home/earnest/anaconda2/envs/py27/bin Installing CRISPRessoPooled script to /home/earnest/anaconda2/envs/py27/bin Installing CRISPResso script to /home/earnest/anaconda2/envs/py27/bin

Installed /home/earnest/anaconda2/envs/py27/lib/python2.7/site-packages/CRISPResso-1.0.8-py2.7.egg Processing dependencies for CRISPResso==1.0.8 Searching for seaborn==0.8.1 Best match: seaborn 0.8.1 Adding seaborn 0.8.1 to easy-install.pth file

Using /home/earnest/.local/lib/python2.7/site-packages Searching for argparse==1.4.0 Best match: argparse 1.4.0 Processing argparse-1.4.0-py2.7.egg argparse 1.4.0 is already the active version in easy-install.pth

Using /home/earnest/.local/lib/python2.7/site-packages/argparse-1.4.0-py2.7.egg Searching for biopython==1.70 Best match: biopython 1.70 Adding biopython 1.70 to easy-install.pth file

Using /home/earnest/.local/lib/python2.7/site-packages Searching for matplotlib==2.1.0 Best match: matplotlib 2.1.0 Adding matplotlib 2.1.0 to easy-install.pth file

Using /home/earnest/anaconda2/envs/py27/lib/python2.7/site-packages Searching for pandas==0.21.0rc1 Best match: pandas 0.21.0rc1 Processing pandas-0.21.0rc1-py2.7-linux-x86_64.egg pandas 0.21.0rc1 is already the active version in easy-install.pth

Using /home/earnest/.local/lib/python2.7/site-packages/pandas-0.21.0rc1-py2.7-linux-x86_64.egg Searching for numpy==1.13.3 Best match: numpy 1.13.3 Adding numpy 1.13.3 to easy-install.pth file

Using /home/earnest/anaconda2/envs/py27/lib/python2.7/site-packages Searching for pyparsing==2.2.0 Best match: pyparsing 2.2.0 Adding pyparsing 2.2.0 to easy-install.pth file

Using /home/earnest/anaconda2/envs/py27/lib/python2.7/site-packages Searching for cycler==0.10.0 Best match: cycler 0.10.0 Adding cycler 0.10.0 to easy-install.pth file

Using /home/earnest/anaconda2/envs/py27/lib/python2.7/site-packages Searching for pytz==2017.2 Best match: pytz 2017.2 Adding pytz 2017.2 to easy-install.pth file

Using /home/earnest/anaconda2/envs/py27/lib/python2.7/site-packages Searching for subprocess32==3.2.7 Best match: subprocess32 3.2.7 Adding subprocess32 3.2.7 to easy-install.pth file

Using /home/earnest/anaconda2/envs/py27/lib/python2.7/site-packages Searching for backports.functools-lru-cache==1.4 Best match: backports.functools-lru-cache 1.4 Adding backports.functools-lru-cache 1.4 to easy-install.pth file

Using /home/earnest/anaconda2/envs/py27/lib/python2.7/site-packages Searching for python-dateutil==2.6.1 Best match: python-dateutil 2.6.1 Adding python-dateutil 2.6.1 to easy-install.pth file

Using /home/earnest/anaconda2/envs/py27/lib/python2.7/site-packages Searching for six==1.11.0 Best match: six 1.11.0 Adding six 1.11.0 to easy-install.pth file

Using /home/earnest/anaconda2/envs/py27/lib/python2.7/site-packages Finished processing dependencies for CRISPResso==1.0.8

Python package installed

Checking dependencies... I cannot create the folder! The folder /home/earnest/CRISPResso_dependencies is not empty! CHECKING DEPENDENCIES... flash is already installed! needle is already installed! All done!%

On Wed, Nov 15, 2017 at 12:48 PM, Luca Pinello notifications@github.com wrote:

You should not run CRISPResso from the master directory. From within that directory try to run:

python setup.py install

This should reinstall CRISPResso for Anaconda and will create the script.

If this doesn't work you may want to consider to use the docker image.

— You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub https://github.com/lucapinello/CRISPResso/issues/33#issuecomment-344723612, or mute the thread https://github.com/notifications/unsubscribe-auth/AfiTjmYQe59rH69XC9uGNCHD3cesv721ks5s204pgaJpZM4QeOg_ .

lucapinello commented 6 years ago

It looks good to me, now it should run fine...

If not check few things:

1) Are you in the correct conda env? (i.e. source activate py27 ) 2) Check if you have something weird in your PATH or PYTHONPATH env variables. 3) try to run:

which CRISPResso

You should get something like this:

~/anaconda2/envs/py27/bin/CRISPResso

If not I guess docker is the fastest way to get CRISPResso up and running.

Best,

Luca

strohmjeff commented 6 years ago

Thanks for your help Luca,

I'm just using the web version for now. It worked great for some 250PE read datasets that I have. I'm now working on a 75bp single-end analysis, and the web version rejects my data with the "unable to align any reads to reference"

I have attached a screenshot from IGV showing how the reads align to the reference. I have tried both the full 800bp region and a 230bp region in which the editing is taking place. Can you see anything wrong with my input? I've been filtering my read files with samtools to only include reads mapped to the region I'm interested in.

igv_screenshot

T2_reference TTTCCACACACTTTTGGGTATTCTCTCCCTTTTTCTTTCAACCCAAAGTTCACCACTGACCATCCCACCCTCATCCCCCCTCCTGGTGGACGGTGCGGTACAGTGTGGGGCACTGAGCCAAGGCCAGCACCCCCGGGCCGCTGTGTGGACTCCATCCTGCCAATCCCACATTGGCGTGGTGCATCTCCCCATTCCTCCTTGGGCTGCATGGGGGTGCCCCTGGAGGCCTTGGCTCAATGCAAGGCTCCTTGGGACAGCTCTGGGAGGTGACAAGACCCCACCCTTCTGCTGCAGGAGCAGGTCCTAGGACTTTGGTTGTGGTCTGTCTGGGCTCCTTCATTTCTGCAGGGGACCCTGGGTGTTAGCAAGTAGCAGCAACACCACAGTTTCCCCTCCTGCACTGGACCCCAGTTGTGCTCAGGTAGCCAGCCCTCCATCCAGGGCCCCTGACTGCTCTCTTCTCTTCTGCCAGCTATAGTGACCTTAGTGATCCCTCCGGGTGGATGGTCCAGTTTGGCCAGCTGACTTCCATGCCATCCTTCTGGAGCCTGCAGGCCTACTACACCCGTTACTTCGTATCGAATATCTATCTGAGCCCTCGCTACCTGGGGAATTCACCCTATGACATTGCCTTGGTGAAGCTGTCTGCACCTGTCACCTACACTAAACACATCCAGCCCATCTGTCTCCAGGCCTCCACATTTGAGTTTGAGAACCGGACAGACTGCTGGGTGACTGGCTGGGGGTACATCAAAGAGGATGAGGGTGAGGCTGGGGACAGGCGGGTCAGGGAGGAACTGTCTTTGTTCACCTGTTCCCC

lucapinello commented 6 years ago

It seems your reads are not overlapping. In this case unfortunately you cannot use CRISPResso.

strohmjeff commented 6 years ago

Got it, thanks for your quick reply