Closed tiramisutes closed 6 years ago
Yes we support single-read.
How big is your dataset (#reads) and how many cpu are you using?
On Mon, Jun 4, 2018 at 12:13 PM, hope notifications@github.com wrote:
Hi, I use the CRISPResso with a Single-Read as follows command.
CRISPResso -r1 sample_R1_001.fastq.gz -a ATATGACCAGGTCGTACACGATGTGGATCTGCAGAAGCTGCCTGTAAGATTTGCAATGGACAGAGCTGGCCTCGTTGGTGCAGATGGTCCAACACATTGTGGGGCTTTTGATGTCACTTTCATG -g TTGGTGCAGATGGTCCAACACAT --name sample -o ${out} --trim_sequences -p ${cpu} -w 20
But It's still in the step "Calculating alleles frequencies" when running long times.
INFO @ Thu, 31 May 2018 14:15:20: Calculating alleles frequencies...
So, whether the CRISPResso is supporting for Single-Read? And what is the best way for the Single-Read sequence?
— You are receiving this because you are subscribed to this thread. Reply to this email directly, view it on GitHub https://github.com/lucapinello/CRISPResso/issues/41, or mute the thread https://github.com/notifications/unsubscribe-auth/ABB_6hvp-iNtFGITAqFzIfjMmFyFvz54ks5t5Qg1gaJpZM4UY0ID .
The single-read is total size 612M in the compressed format (sample.fq.gz) and I use 20 CPU.
Hi Hope, This is much bigger than our usual samples. Unfortunately, there is not much more you can do to speedup CRISPResso. We are working on a new version of CRISPResso that is ~10X faster, this may be a solution to your problem. We should have a first version ready in about 2-3 weeks.
Hi, I use the CRISPResso with a Single-Read as follows command.
But It's still in the step "Calculating alleles frequencies" when running long times.
So, whether the CRISPResso is supporting for Single-Read? And what is the best way for the Single-Read sequence?