search

lucapinello / CRISPResso

Software pipeline for the analysis of CRISPR-Cas9 genome editing outcomes from sequencing data
Other
131 stars 55 forks source link

Error while generating plots with Cpf1 data #44

Closed dfajar2 closed 6 years ago

dfajar2 commented 6 years ago

I have been using CRIPResso with Cas9 and Cpf1. So far, all the Cas9 experiments are fine, but when I ran the Cpf1 I get an error when generating the plots. I should say that the plots 1a, 1b, 2, 3, 4a, 4b, and 4e are generated. It seems to fail while generating plot 9. BTW I am specifying "--guide_seq" and also "--cleavage_offset 1" when running Cpf1.

Here's the last section of the log file: .... INFO @ Thu, 28 Jun 2018 14:53:51: Calculating alleles frequencies...

INFO @ Thu, 28 Jun 2018 14:55:38: Done!

INFO @ Thu, 28 Jun 2018 14:55:38: Making Plots...

CRITICAL @ Thu, 28 Jun 2018 14:55:49: Unexpected error, please check your input.

ERROR: 'N'

lucapinello commented 6 years ago

Hi there,

Thanks for using CRISPResso.

Which version are you using?

Do you have many reads with 'N' in this sample?

Can you share with us the fastq files and the full report?

Thanks,

On Thu, Jun 28, 2018 at 3:58 PM dfajar2 notifications@github.com wrote:

I have been using CRIPResso with Cas9 and Cpf1. So far, all the Cas9 experiments are fine, but when I ran the Cpf1 I get an error when generating the plots. BTW I have used the "--cleavage_offset 1" when running Cpf1.

Here's the last section of the log file: .... INFO @ Thu, 28 Jun 2018 14:53:51: Calculating alleles frequencies...

INFO @ Thu, 28 Jun 2018 14:55:38: Done!

INFO @ Thu, 28 Jun 2018 14:55:38: Making Plots...

CRITICAL @ Thu, 28 Jun 2018 14:55:49: Unexpected error, please check your input.

ERROR: 'N'

— You are receiving this because you are subscribed to this thread. Reply to this email directly, view it on GitHub https://github.com/lucapinello/CRISPResso/issues/44, or mute the thread https://github.com/notifications/unsubscribe-auth/ABB_6uaeK23I77USTMUGxZ6z-Y7ib_pZks5uBTVTgaJpZM4U7_Nh .

dfajar2 commented 6 years ago

Sure here they are. I thought it was the Ns in the reads, but there doesn't seem to be a problem with the Ns with the Cas9s. Thanks

CRISPResso_RUNNING_LOG.txt

13-Cpf1-38337AS_S13_L001_R1_001.fastq.gz 13-Cpf1-38337AS_S13_L001_R2_001.fastq.gz

Here are also the amplicon and guide sequences

-a tccatttcatagtctttccttgggtgtgttaaaagtgaccatggtacactcagcacggatgaaatgaaacagtgtttagaaacgtcagtcttctcttttgtaatgccctgtagtctctctgtatgttatatgtcacattttgtaattaacagcttgctggtgaaaaggaccccacgaagtgttggatataagccagactgtaagtgaattactttttttgtcaatcatttaaccatctttaacctaaaagagttttatgtgaaatggcttataattgcttagagaatatttg -g GGTTAAAGATGGTTAAATGAT

lucapinello commented 6 years ago

Fixed with Version 1.0.13!

The problem was that we never had a sample with most common alleles with N.

Please let me know how it goes.

dfajar2 commented 6 years ago

thanks!!! I'll give it a try.