search

lucapinello / CRISPResso

Software pipeline for the analysis of CRISPR-Cas9 genome editing outcomes from sequencing data
Other
131 stars 55 forks source link

ERROR: Flash failed to run, please check the log file. #49

Closed madeleinesitton closed 5 years ago

madeleinesitton commented 5 years ago

Hi,

I am trying to install CRISPResso on my computer, but am having trouble using FLASH. Here's the output I get when I try to run the example files:

CRISPResso -r1 reads1.fastq -r2 reads2.fastq -a GCTTACACTTGCTTCTGACACAACTGTGTTCACGAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGAATGCCGTCACCACCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGA -e GCTTACACTTGCTTCTGACACAACTGTGTTCACGAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGTGGAAAAAAACGCCGTCACGACGTTATGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGA


-Analysis of CRISPR/Cas9 outcomes from deep sequencing data-

                      )
                     (
                    __)__
                 C\|     |
                   \     /
                    \___/

[Luca Pinello 2015, send bugs, suggestions or *green coffee* to lucapinello AT gmail DOT com]

Version 1.0.13

WARNING @ Mon, 12 Nov 2018 14:47:51:
     Folder CRISPResso_on_reads1_reads2 already exists. 

INFO  @ Mon, 12 Nov 2018 14:47:51:
     Estimating average read length... 

INFO  @ Mon, 12 Nov 2018 14:47:53:
     Merging paired sequences with Flash... 

CRITICAL @ Mon, 12 Nov 2018 14:47:53:
     Merging error, please check your input.

ERROR: Flash failed to run, please check the log file.

The running log says:
[Execution log]:
Estimating average read length...
Merging paired sequences with Flash...
/bin/sh: /Users/madeleinesitton/CRISPResso_dependencies/bin/flash: cannot execute binary file
Merging error, please check your input.

ERROR: Flash failed to run, please check the log file.

Thank you for the help!!
lucapinello commented 5 years ago

It seems flash is not properly installed on your machine. Check that you can execute the binary of flash and try again.