search

mahulchak / quickmerge

A simple and fast metassembler and assembly gap filler designed for long molecule based assemblies.
GNU General Public License v3.0
198 stars 31 forks source link

An error when running quickmerge #7

Closed tangerzhang closed 8 years ago

tangerzhang commented 8 years ago

Hello, I had a problem when running quickmerge. The error message like below: " terminate called after throwing an instance of 'std::out_of_range' what(): basic_string::substr: __pos (which is 3152) > this->size() (which is 0) run.sh: line 5: 26095 Aborted quickmerge -d out.rq.delta -q secondary_contigs.fasta -r pb.only.fasta -hco 5.0 -c 1.5 -l n " I know that you already have an explanation for this issue: probably because of the mis-formated fasta header line with white space. However, I checked my two fasta files and there are no white space in the header line. Thus I guess the mis-formated fasta file is not my case. I attached what my files looks like:

less pb.only.fasta

000000F CACCTCGTCGGGGAAGGAGATAGCTTCCTCACGCCAT less hy.asm.fasta scf7180000332062 GAGGAGACACCGTGCTACTAGGTGGTTGTGCCACCGGAGCAGCCACACCCTTTAACAGGT

Looking forward to your suggestion! Thanks a lot!

mahulchak commented 8 years ago

Hi, did you change 'n' to a number (i.e. what is the value of l)? Another thing which we mention and would like to rule out here is that your fasta files do not have line breaks in them. Could you check that? PBcR assemblies typically have line breaks in them.

On Mon, May 23, 2016 at 11:09 PM Tanger Zhang notifications@github.com wrote:

Hello, I had a problem when running quickmerge. The error message like below: " terminate called after throwing an instance of 'std::out_of_range' what(): basic_string::substr: __pos (which is 3152) > this->size() (which is 0) run.sh: line 5: 26095 Aborted quickmerge -d out.rq.delta -q secondary_contigs.fasta -r pb.only.fasta -hco 5.0 -c 1.5 -l n " I know that you already have an explanation for this issue: probably because of the mis-formated fasta header line with white space. However, I checked my two fasta files and there are no white space in the header line. Thus I guess the mis-formated fasta file is not my case. I attached what my files looks like: less pb.only.fasta

000000F CACCTCGTCGGGGAAGGAGATAGCTTCCTCACGCCAT less hy.asm.fasta scf7180000332062 GAGGAGACACCGTGCTACTAGGTGGTTGTGCCACCGGAGCAGCCACACCCTTTAACAGGT

Looking forward to your suggestion! Thanks a lot!

— You are receiving this because you are subscribed to this thread. Reply to this email directly or view it on GitHub https://github.com/mahulchak/quickmerge/issues/7

tangerzhang commented 8 years ago

OK, I see. I have one fasta file which has break lines; while another does not have break lines. Thanks for your clarification!

2016-05-24 17:01 GMT+08:00 Mahul Chakraborty notifications@github.com:

Hi, did you change 'n' to a number (i.e. what is the value of l)? Another thing which we mention and would like to rule out here is that your fasta files do not have line breaks in them. Could you check that? PBcR assemblies typically have line breaks in them.

On Mon, May 23, 2016 at 11:09 PM Tanger Zhang notifications@github.com wrote:

Hello, I had a problem when running quickmerge. The error message like below: " terminate called after throwing an instance of 'std::out_of_range' what(): basic_string::substr: __pos (which is 3152) > this->size() (which is 0) run.sh: line 5: 26095 Aborted quickmerge -d out.rq.delta -q secondary_contigs.fasta -r pb.only.fasta -hco 5.0 -c 1.5 -l n " I know that you already have an explanation for this issue: probably because of the mis-formated fasta header line with white space. However, I checked my two fasta files and there are no white space in the header line. Thus I guess the mis-formated fasta file is not my case. I attached what my files looks like: less pb.only.fasta

000000F CACCTCGTCGGGGAAGGAGATAGCTTCCTCACGCCAT less hy.asm.fasta scf7180000332062 GAGGAGACACCGTGCTACTAGGTGGTTGTGCCACCGGAGCAGCCACACCCTTTAACAGGT

Looking forward to your suggestion! Thanks a lot!

— You are receiving this because you are subscribed to this thread. Reply to this email directly or view it on GitHub https://github.com/mahulchak/quickmerge/issues/7

— You are receiving this because you authored the thread. Reply to this email directly or view it on GitHub https://github.com/mahulchak/quickmerge/issues/7#issuecomment-221208500

jgbaldwinbrown commented 8 years ago

Hi, Glad to hear that it's working for you. In the future, you can pretty easily avoid these problems by never calling the quickmerge executable, and instead using the "merge_wrapper.py" wrapper for the program. This runs MUMmer and delta-filter for you (you can turn this part off if those steps are complete), and it will auto-generate correctly formatted fasta files if it detects problems with your input fasta files, i.e. line breaks.