Open galaxy001 opened 11 months ago
Hi, I’m not sure I understand what format the data is in. Can you describe what exactly is in R1 and R2 or do you have a link?
Would it be enough to be able to search for the reverse-complemented barcodes?
The Read 1 Fastq:
@Pro31:S:PRM32402100029:1:000000:R001:C001 1:L:0
TAGATGGCTCATCCGTATCGCGGGTCACCGATGACAGATG
+
CCCC@CC@AAA@DCC@BB@CD@CC@C@CCCDCC@CB=BBB
@Pro31:S:PRM32402100029:1:000001:R001:C001 1:L:0
TTCAAGTCGGGATTCGGGTTGAGCCATTTTACCAGGGGAA
+
@@@@CB@CDBDC@@D@@B@@@DDCCB@@@DC@B@@BBC@C
The Read 2 Fastq:
@Pro31:S:PRM32402100029:1:000000:R001:C001 2:L:0
TCTTCCTGGATTTTTTTAAATCATTTTTATCTCAGAACTTAAACAAAAATTAGATGTCGTGCACGGACTGTGTGAAAGAAGATGCTTTGCATATTTGCTG
+
A@@BABDBEDBBCCBC@BBCCA@@B@CD?CACABDDCBBCCACABACABC@@C;ACBCA?ADBBB@@DBD?B@CD@BBC@@BC@>B@B<BB@FCCAC@BB
@Pro31:S:PRM32402100029:1:000001:R001:C001 2:L:0
GGGTGACACAGCAACACCTCGTCACAAAAAAAAAAAAAAAAAAAAAAAAAATTCCCCTGGTGCGAGAGTCGGGGGGGTTGTAGTAACAAGATATGCCCCC
+
@EBBC@D@BCBB@CDCCBCC@@C@CB@D@CB@AD@ACFCDDBA@BD@@@?+A9D@@<,=&$1$,7*$-739'B@$'',21&@/'$:,<8**9%=.6,8D0
Read 1 come with Read Structure 30B10M, but the first 30bp have to be reverse-complemented for downstream programme like STAR. Those reverse-complemented 30 bp will be used as spot barcode.
Read 2 is ordinary RNASeq data from the spot.
Thanks, this is helpful. I will probably not be able to add something like this right now, but let’s leave the issue open as a reminder.
Some barcode sequencing methods produce barcode fastq file in reverse complement form, thus one of the paired fastq files need to be reverse complement back.
It will be convenient if cutadapt can offer this function.