Issue importing fasta files to Cutadapt virtual environment

[elkst00]

I am following along with the documentation, attempting to demultiplex combinatorial dual indexed sequences. I am unsure how to read the barcode fasta file into the Cutadapt virtual environment. This is my code:

cutadapt \ -e 0.15 --no-indels \ -g ^file:barcodes_fwd.fasta \ -G ^file:barcodes_rev.fasta \ -o {ACACTCTTTCCCTACACGACGCTCTTCCGATCT }-{GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT }.1.fastq.gz -p \ {ACACTCTTTCCCTACACGACGCTCTTCCGATCT }-{GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT }.2.fastq.gz \ input.1.fastq.gz input.2.fastq.gz

This is the error message I receive:

[Errno 2] No such file or directory: 'barcodes_fwd.fasta'

I am running Cutadapt V4.9 on Python V 3.12.4, installed with Miniconda. Mac OS with Ventura.

[marcelm]

You need to create the barcodes_fwd.fasta and barcodes_rev.fasta files. Read also the general section about demultiplexing in the documentation, which describes how such a barcodes.fasta file needs to look.